ID: 1009847058

View in Genome Browser
Species Human (GRCh38)
Location 6:69146971-69146993
Sequence ACTGATAAGCAGAAATTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 1, 2: 3, 3: 32, 4: 316}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009847058_1009847062 18 Left 1009847058 6:69146971-69146993 CCTTTGAATTTCTGCTTATCAGT 0: 1
1: 1
2: 3
3: 32
4: 316
Right 1009847062 6:69147012-69147034 ATTTCTGATTTTATTTATTTGGG 0: 86
1: 415
2: 539
3: 716
4: 3159
1009847058_1009847061 17 Left 1009847058 6:69146971-69146993 CCTTTGAATTTCTGCTTATCAGT 0: 1
1: 1
2: 3
3: 32
4: 316
Right 1009847061 6:69147011-69147033 CATTTCTGATTTTATTTATTTGG 0: 133
1: 506
2: 978
3: 1348
4: 2130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009847058 Original CRISPR ACTGATAAGCAGAAATTCAA AGG (reversed) Intronic
902358681 1:15928695-15928717 ACTGACAAGCAGAAACGCAAAGG + Exonic
904527773 1:31147071-31147093 AATGATAAGAAGAGATCCAAGGG + Intergenic
906937844 1:50229938-50229960 ACTGATATGAAGAAATACTAGGG + Intergenic
907117812 1:51984906-51984928 ACTGAAAATGAGAAATTAAAAGG + Intronic
907139232 1:52170286-52170308 ACTGATACCAAGAAATTCAAAGG - Intronic
908813665 1:68009776-68009798 ACTCATAAGATGAGATTCAAAGG - Intergenic
909836120 1:80257721-80257743 CTTGATGAGCAGGAATTCAATGG + Intergenic
909879645 1:80858239-80858261 ACTGATAACCAGCAAGACAATGG + Intergenic
909943335 1:81635406-81635428 ACTGATAAGATGACATGCAAAGG - Intronic
910451163 1:87346978-87347000 CCTGATATGTACAAATTCAAAGG + Exonic
911569557 1:99506937-99506959 ACTGATACTAAGAAATGCAAAGG + Intergenic
913399953 1:118420964-118420986 ACTCATAAGCAGAAAGTTAGAGG - Intergenic
913417921 1:118632576-118632598 ACTGATATCAAGAAATACAAAGG - Intergenic
914471935 1:147987970-147987992 AATGAAAAGCAGGAATTAAAAGG - Intronic
914955906 1:152162077-152162099 ACTGAGAAGCACAAATTCTGAGG - Intergenic
915853605 1:159355009-159355031 ACTGATACCCAGAAATGCAAAGG - Intergenic
916234496 1:162573098-162573120 ACTGAGATGAAGAAATTTAAAGG - Intronic
916312174 1:163409663-163409685 CCTGGTAAGGAGAATTTCAAAGG - Intergenic
918111897 1:181462252-181462274 CCTGATAAGGAGAAATTCCTAGG + Intronic
918489855 1:185069940-185069962 CCTCATAAGCAGAAAATCAATGG - Intronic
918947428 1:191085918-191085940 ACTTATACACAGAAATGCAAAGG + Intergenic
919113840 1:193256099-193256121 ACTGAAAAGCAGATAATCAAAGG - Intergenic
919529517 1:198699629-198699651 ACTGACACGCAGACATTCAGCGG + Exonic
921622476 1:217341084-217341106 ACGGCTAAGCCCAAATTCAAAGG - Intergenic
921903174 1:220469250-220469272 ACTGAAAAGGAGAAATTGCATGG + Intergenic
923846640 1:237740990-237741012 ACAGAGCAGCAGAAACTCAAAGG + Intronic
924425038 1:243943017-243943039 AGTGGGATGCAGAAATTCAAGGG - Intergenic
924668524 1:246099109-246099131 ACTGATAAGTTGAAAATAAATGG + Intronic
1062846077 10:706854-706876 AATGGCAAGCAGAAATTCAGGGG - Intergenic
1065018915 10:21486496-21486518 ACACAGAAGCAGAGATTCAAGGG + Intergenic
1066277071 10:33879770-33879792 ACTGCTAAGCAGAAATTAAAAGG - Intergenic
1066973842 10:42345312-42345334 ACTAATAATAAGAAATTAAATGG + Intergenic
1067973521 10:50997609-50997631 TCTGATAAGCAGATTCTCAATGG - Intronic
1068732831 10:60378357-60378379 AATGATAAGCATAAAATAAAAGG + Intronic
1070222578 10:74464852-74464874 AGAGAGAAGCAGAAATTCAAAGG + Intronic
1071590454 10:86867904-86867926 ACAGTTGAGCAGAAATACAAAGG + Intronic
1072086702 10:92086702-92086724 AATGTTAAGCAGAGATTCACAGG - Intronic
1072632375 10:97155263-97155285 CCTGGGAAGCAGAAAGTCAAGGG - Intronic
1072754724 10:98011702-98011724 ACTGATATGCAGCAAGCCAAAGG + Intronic
1072776360 10:98199338-98199360 ATTGATAAGCAGATATTTATTGG - Intronic
1074713272 10:116195329-116195351 AATGTTAAGCAGATATTAAAAGG - Intronic
1075334628 10:121599220-121599242 ATTAATAAAAAGAAATTCAAAGG + Intergenic
1075818013 10:125280889-125280911 AAGGATAAGCACAAAGTCAAAGG - Intergenic
1077978901 11:7278819-7278841 ACTGATGAGCACAAATGTAAAGG + Intronic
1078244118 11:9557986-9558008 ACTGATACCAAGAAATTCAAAGG - Intergenic
1078380006 11:10831367-10831389 ACTAATAAGCTGAAAGCCAAAGG - Intronic
1078674956 11:13401995-13402017 CCTGAGAAGAAGACATTCAAGGG - Intronic
1079925332 11:26485954-26485976 ACTGATATCCAGAATTTAAAAGG + Intronic
1080194381 11:29591663-29591685 ACTGATAAGATTAATTTCAAAGG + Intergenic
1082669855 11:56022256-56022278 GCTGATAAACAGAAGTTAAAAGG + Intergenic
1083910041 11:65701925-65701947 AATGGTATACAGAAATTCAATGG - Intergenic
1084628415 11:70327887-70327909 ACTGAAAAGCAGACATTCAACGG - Intronic
1084754365 11:71225637-71225659 ACTGAAAAAAAGAAAATCAATGG + Intronic
1090239064 11:125169329-125169351 ACTGAGAAGCAGAATTTAGAGGG + Intronic
1090545547 11:127762885-127762907 ATTGAGCAGCAGAAATTCACAGG + Intergenic
1090767893 11:129892895-129892917 ACAGAAAGGCAGAAATTCCAGGG + Exonic
1092966212 12:13645954-13645976 AATGATTAGAAGAAACTCAAAGG + Intronic
1093979420 12:25459465-25459487 ACTAATAAACTGAAATTCCAGGG + Intronic
1094194983 12:27739811-27739833 AATGATAGGCATAAATTCAGTGG + Intronic
1097992214 12:65847870-65847892 ACTGGAAAACAAAAATTCAAAGG - Intronic
1100908304 12:99328133-99328155 ACTGAAAAGCAGGAAATGAAGGG + Intronic
1104089580 12:125504156-125504178 TCAGCTAAGCAGAAAGTCAATGG - Intronic
1105229461 13:18477025-18477047 ACTAATAATAAGAAATTAAATGG + Intergenic
1105832486 13:24176485-24176507 TCTGAAAAGCAGAAATTAAAAGG - Intronic
1106262669 13:28081386-28081408 ACTAACAATCAGAAATTGAAGGG - Intronic
1107267461 13:38573918-38573940 ACTGATTGGAAGAAGTTCAAAGG + Intergenic
1107911980 13:45114025-45114047 ACTGAACAGAAGCAATTCAACGG + Intergenic
1108125161 13:47234557-47234579 ACTGAGAAGCAGATATTTGAGGG + Intergenic
1110086144 13:71382818-71382840 AATGATAATGAGAAATGCAAAGG - Intergenic
1110162179 13:72391623-72391645 ATTGATGAGCAGAAGTGCAAAGG + Intergenic
1111077475 13:83256654-83256676 TATGATAAGCAGCAATTCATAGG - Intergenic
1111737655 13:92163157-92163179 ACTGATAAGAATAAATTTGATGG + Intronic
1113215778 13:108039413-108039435 CCTGGTAGGCAGAAATGCAAAGG - Intergenic
1113391175 13:109898810-109898832 ACTCATTAGCACAAAGTCAAAGG + Intergenic
1113392301 13:109909306-109909328 ACTCATCACCAGAAAGTCAAAGG + Intergenic
1113979302 13:114259926-114259948 ACTCATAAGCACCAATTCACGGG - Intronic
1114340912 14:21742834-21742856 ACAGAGTAGCTGAAATTCAAGGG + Intergenic
1115080767 14:29447596-29447618 ACATCTAAGCAGAATTTCAAAGG + Intergenic
1115129448 14:30037019-30037041 ACTTAAAAGAAGAAACTCAAGGG - Intronic
1116004107 14:39274211-39274233 TCTGATAAACTGAAATTTAAAGG - Intronic
1117225107 14:53650189-53650211 ATAGATATGCAGAAATGCAAGGG - Intergenic
1117661564 14:58011201-58011223 ACTGAGAAGCAGAAATAGTAAGG + Intronic
1118012947 14:61628619-61628641 AATGATGGGCAGAAATTCAGGGG - Intronic
1118266195 14:64296815-64296837 AATAATAAGCAGAAAATGAATGG + Intronic
1118300528 14:64611579-64611601 ACTGCTAGGCAGTAATTAAAAGG + Intergenic
1118511811 14:66483415-66483437 ATAGATAAGCAGAAGTTCAAGGG - Intergenic
1119226823 14:72950748-72950770 TCAGATAAGCAGAAATTTTAAGG + Intronic
1120131666 14:80815173-80815195 ACTGATAAACAGAATTTACAAGG + Intronic
1123136925 14:106036550-106036572 ACTGATAGGCAGAATTTACACGG - Intergenic
1126408014 15:48342764-48342786 CCTGATGAGATGAAATTCAAGGG - Exonic
1127751921 15:62054341-62054363 AAGCATAAGCATAAATTCAAAGG + Intronic
1128265185 15:66259918-66259940 AGTGATGAGCAGAATTTTAAAGG - Intergenic
1128483750 15:68064519-68064541 TCTGATAAACTGAAATTCATTGG - Intronic
1129884037 15:79026343-79026365 AAGGATAAGCAGGAATTCACAGG - Intronic
1130674647 15:85940954-85940976 ACTAATAAGCAGAAGAGCAAGGG - Intergenic
1130920672 15:88341884-88341906 ACTGATAAGGAGAAATTGCTTGG - Intergenic
1131903432 15:97114771-97114793 AATGTTATGCAGAAATTCCAAGG - Intergenic
1132979840 16:2731876-2731898 ACTTATTAGGAGAAATCCAAAGG - Intergenic
1134104457 16:11476015-11476037 ACTTTTGAGCAGAAATCCAAAGG + Intronic
1134202745 16:12212327-12212349 CCTGAGAAGCGGAAAGTCAATGG - Intronic
1134407221 16:13971136-13971158 ACTGATCAGCAAAAATTAAAAGG - Intergenic
1134857754 16:17534919-17534941 TCAGATATGCAGAAATTCTAAGG + Intergenic
1135202624 16:20451780-20451802 ACAGAAAAGCAGAAATTCCTAGG + Intronic
1135216478 16:20576086-20576108 ACAGAAAAGCAGAAATTCCTAGG - Intronic
1135820024 16:25676488-25676510 CCTGTTAGGCAGAAATGCAATGG - Intergenic
1137054989 16:35740892-35740914 ACTGATAGGTGGAAATTCAGTGG + Intergenic
1137889145 16:52140168-52140190 TATGAAAAGAAGAAATTCAAAGG + Intergenic
1138062005 16:53901627-53901649 ACTGACAAGCTGAAGTGCAATGG - Intronic
1138931118 16:61657148-61657170 ACTGATGATCAGAAATTGGATGG - Intronic
1140523557 16:75603107-75603129 GCTGCTAAGCAGAATTGCAAGGG - Exonic
1142224011 16:88868731-88868753 ACTGCCAATCAGAGATTCAAAGG - Intergenic
1142264856 16:89058938-89058960 ACTGATGGGCAGAAGGTCAAGGG - Intergenic
1146576636 17:33999226-33999248 ACACATAGGCTGAAATTCAAGGG - Intronic
1146684212 17:34829718-34829740 AATTAAAAGCAGAAAATCAAAGG - Intergenic
1146966129 17:37031760-37031782 ACTGATAAGAAGAAATGGAGAGG - Intronic
1147328358 17:39681176-39681198 TCTTATAAGCAGAAACACAAGGG + Intronic
1148248820 17:46055697-46055719 TCTGATAAGCAAAAATACAGGGG + Intronic
1151430901 17:74062176-74062198 TCTGAAAAGCAGAAATTTATAGG + Intergenic
1152051597 17:77983182-77983204 AATGGGAAGCAGAAATTCTAGGG - Intergenic
1152854601 17:82657504-82657526 AGTGATTAGTATAAATTCAATGG - Exonic
1154072351 18:11164017-11164039 ACTGATAAGCACAGACACAAAGG + Intergenic
1154163981 18:12000467-12000489 ACTGGCAAACAGAAATTCAGAGG - Intronic
1154417229 18:14185526-14185548 ACTGAAAAGGAGAACTTCGAAGG - Intergenic
1154523986 18:15263104-15263126 ACTAATAATAAGAAATTAAATGG - Intergenic
1155210873 18:23600829-23600851 ACTGAAAAGCTGACCTTCAATGG - Exonic
1155311570 18:24529446-24529468 ACAGGTGAGCAGAAATTAAAGGG - Intergenic
1155764922 18:29616673-29616695 ACTGATGAGCTGAAAATAAAAGG + Intergenic
1156230102 18:35145330-35145352 ACTGAGAATCGTAAATTCAAAGG - Intergenic
1157036453 18:43980515-43980537 ACAGATAAGCATAAATTTACTGG - Intergenic
1157889252 18:51399233-51399255 TCTGAGAAGCAGGAAATCAAAGG + Intergenic
1159012862 18:63074768-63074790 CCTCAGAAGCAGAAATCCAAAGG - Intergenic
1159691939 18:71499262-71499284 AATAAAAAGAAGAAATTCAAGGG - Intergenic
1160286696 18:77549614-77549636 ACAGAGAAACAGACATTCAAGGG - Intergenic
1163276825 19:16290102-16290124 ACAGACAGGCAGAAATTGAAGGG + Intergenic
1163674651 19:18649446-18649468 GCGGAGAAGCAGAAATTCACAGG + Intronic
1165171261 19:33893438-33893460 ACTGTTAAGCAGTTTTTCAAAGG + Intergenic
1166016267 19:39981439-39981461 ACTTCTAAGAAGAAATTAAATGG - Exonic
1166277894 19:41767835-41767857 ACTGAGAAACAGAAACTAAAAGG + Intronic
1166897181 19:46031265-46031287 TCTGAGAAGCAGATATTCAGGGG - Intergenic
925651679 2:6096983-6097005 AAAGATAAGCAGAGATGCAATGG + Intergenic
925832720 2:7911824-7911846 ACAGCTAGGCAGAAACTCAAAGG + Intergenic
925918009 2:8620892-8620914 ACTGGTAAGTAGAAAGTCAAGGG - Intergenic
926375158 2:12219917-12219939 ACTGATCAGCAGCAATACAAAGG + Intergenic
927358816 2:22207904-22207926 ACTAAAAAGGAGAAATTCAGAGG - Intergenic
927832689 2:26366604-26366626 ACTGAGAATCAGAAAGTCTAGGG - Intronic
928491822 2:31792340-31792362 ACTCAGAAGCAGAAAGTCAATGG + Intergenic
928624409 2:33124930-33124952 ACTGATAATAAGAAGTTCAAAGG - Intronic
930787918 2:55289222-55289244 ACTGAAAAGCTGAAATTTAATGG - Exonic
933583549 2:84154748-84154770 ACTGCTAAGTATAAACTCAAGGG - Intergenic
934153027 2:89167617-89167639 AATGATGAGAAGAAATGCAATGG + Intergenic
934214212 2:90014314-90014336 AATGATGAGAAGAAATGCAATGG - Intergenic
935452035 2:103221081-103221103 ACTCACAAGCTGAAATTCCAAGG + Intergenic
936691201 2:114891260-114891282 AGGGACAAGTAGAAATTCAAGGG + Intronic
936925060 2:117728466-117728488 ACTGATAAACAGTATTTAAAAGG + Intergenic
937617936 2:123948472-123948494 ACTGATACTGCGAAATTCAAAGG + Intergenic
938523239 2:132095622-132095644 ACTAATAATAAGAAATTAAATGG - Intergenic
939542945 2:143515766-143515788 ACTTATATGTAGAAAATCAATGG + Intronic
939910109 2:147971383-147971405 ACTGAAAATCAGAAATATAAAGG + Intronic
941015426 2:160350535-160350557 ACTGTTAGGCAGACATTGAAAGG + Intronic
941407485 2:165109146-165109168 ACTGAGAAGTAGTAATTAAAAGG - Intronic
941654245 2:168126199-168126221 ACTGATAAGACAAAAATCAATGG + Intronic
942643460 2:178085678-178085700 ATTTATAAGCAGGGATTCAAGGG + Intronic
943434556 2:187848371-187848393 ACTGATTAGGAGAAACTCACAGG + Intergenic
943667761 2:190628167-190628189 AATGATCTGCAGAAATTCAGTGG - Intergenic
943878095 2:193100941-193100963 AATGATCAGAAGAAATTAAAAGG - Intergenic
945480098 2:210335507-210335529 ACTGATAAGCTCAAAATAAAGGG - Intergenic
947270300 2:228327055-228327077 AGTGAAAAGCAGAAAAACAATGG + Intergenic
1170355102 20:15483725-15483747 ACTGATAAAAAAAAAATCAAAGG - Intronic
1170879486 20:20283412-20283434 ACAGATAAGTAGAAAGTAAATGG - Intronic
1172091442 20:32435650-32435672 ATTGAAAAGCTGAAAATCAACGG + Exonic
1172394532 20:34591059-34591081 ACAGAAAAGCTGAAAATCAAAGG + Intronic
1173344438 20:42185826-42185848 AGTAATAAGCAGAAAATAAATGG + Intronic
1174188229 20:48722031-48722053 ACTCAAATGCAGAAACTCAACGG + Intronic
1174291917 20:49514836-49514858 ACGGCTGAGCATAAATTCAAAGG - Intronic
1174818343 20:53705708-53705730 AATAATAAGAAGAAAATCAAAGG - Intergenic
1176773448 21:13105384-13105406 ACTAATAATAAGAAATTAAATGG + Intergenic
1177213358 21:18097437-18097459 ACTGAAAAACAGAAATAAAAAGG + Intronic
1177704247 21:24679544-24679566 ATTTATAAGCAGATATACAAAGG + Intergenic
1179263793 21:39784106-39784128 TCTGGGAAGCAGAAATTGAAAGG + Intronic
1179422919 21:41250327-41250349 AGTGATAAGCAGAAAGTCCTTGG + Intronic
1180521073 22:16205086-16205108 ACTAATAATAAGAAATTAAATGG + Intergenic
949090072 3:16973-16995 ACTTATAACTAAAAATTCAAGGG - Intergenic
950191576 3:10980301-10980323 GCAGACAAGCAGAAATCCAAGGG + Intergenic
950813484 3:15673140-15673162 ACTGCTAAGCCAAAATCCAAAGG - Intronic
951236439 3:20241262-20241284 AGTGCTAAGCAAGAATTCAATGG - Intergenic
951493759 3:23302040-23302062 ACTGACAAGGAGAAATAAAAGGG - Intronic
951497300 3:23344452-23344474 ACTGAAAAAAAAAAATTCAAAGG - Intronic
952625166 3:35394214-35394236 AAGGATAAGGAGAAATTTAATGG + Intergenic
953248301 3:41217735-41217757 TCTGATAAGCAAAAAGTAAATGG + Intronic
953440556 3:42913061-42913083 ATAGATAAGCAGAAATTTGATGG - Intronic
956884398 3:73544588-73544610 AATGATAAACAAACATTCAAAGG + Intronic
957029739 3:75226661-75226683 ACTTATAACTAAAAATTCAAGGG - Intergenic
958083572 3:88778131-88778153 ACTGATATGCTGAAGTTCAAAGG + Intergenic
959102071 3:102022122-102022144 TATTATAAGCAGAAATGCAAAGG - Intergenic
959120901 3:102230814-102230836 ACTGAGAAACTCAAATTCAAGGG - Intronic
960902039 3:122563563-122563585 ACTGTCCAGCAGAAATACAATGG - Intronic
961055924 3:123788952-123788974 TCTGATAAGAATAAATTCCAGGG + Intronic
963516276 3:146312887-146312909 ACTGATACCCAGAAATACAAAGG - Intergenic
964314894 3:155433470-155433492 ACCGTTAAGAAGAAACTCAAAGG + Intronic
964551816 3:157893129-157893151 AATATTAAGCAGAAATCCAATGG - Intergenic
964685434 3:159391026-159391048 ACTGAAAAGGAGACATTTAAAGG - Intronic
965006716 3:163036047-163036069 ACTGATAAGCAAGAAAACAAAGG - Intergenic
967795562 3:193594857-193594879 ATTGAGAAGTAGAAATGCAAGGG - Intronic
968094462 3:195918454-195918476 ACGGACACGCAGAAATTGAAGGG + Intergenic
970086392 4:12352072-12352094 ACAGATAAGCAGCAACTCATAGG - Intergenic
970362620 4:15324932-15324954 ACTGATACACAGAAGTTAAAAGG - Intergenic
970948299 4:21721560-21721582 ACTTATAAGCAAAAATTGAGTGG - Intronic
971148448 4:24005456-24005478 ACAGATTAGCAGACTTTCAAGGG - Intergenic
971735209 4:30440153-30440175 ACTGATAAGAACAAATACACGGG + Intergenic
971926991 4:33024063-33024085 TCTGATAAGCCCAAATTGAAGGG - Intergenic
972781441 4:42290158-42290180 TCTGATAAGCAGAAGTCCATGGG - Intergenic
973318629 4:48787163-48787185 ACAGAGAAGCAGAAAAACAAAGG + Intergenic
974505510 4:62765628-62765650 AATGATAAATAGAAATTCATTGG + Intergenic
974634924 4:64550459-64550481 ACTATAAAGCAGAAAATCAAAGG - Intergenic
974982546 4:68977589-68977611 ACTGATACACAAAAATACAAAGG + Intergenic
974990768 4:69085844-69085866 ACTGATACACAGAAATACAATGG - Intronic
975018009 4:69448416-69448438 ACTGATACACAAAAATACAAAGG - Intergenic
975382052 4:73712006-73712028 ACAGAGAAGCAAAAATTCTAAGG + Intergenic
975666093 4:76736326-76736348 ACAGATAGGTATAAATTCAAGGG - Intronic
976312871 4:83629782-83629804 ACTGATTAGAAGTAATTCACAGG - Intergenic
976395202 4:84547889-84547911 CCTGATAGGCAGAAAGCCAAAGG - Intergenic
977064014 4:92290394-92290416 ATTGATACACAGAAATACAAAGG - Intergenic
977456659 4:97270294-97270316 AGTGATAAGCAAAATTTCAGTGG + Intronic
977536097 4:98258905-98258927 AATGATGAGCAGCAATGCAAAGG + Intergenic
977549092 4:98421678-98421700 ACTGATATTTAGAAATTAAATGG + Intronic
977648317 4:99439625-99439647 ACTGATAATTGGAAATGCAAGGG + Intergenic
978507123 4:109470744-109470766 ACTGCTATTCAGAAATCCAATGG - Intronic
979270715 4:118757501-118757523 ACTGATAAAAAGAAATGCTATGG - Intronic
979577327 4:122309423-122309445 ACTGGAAACCAGAAATTCATGGG + Exonic
980309415 4:131106203-131106225 AAAGAGAAGCAAAAATTCAAGGG - Intergenic
980459680 4:133092279-133092301 TCTGAGAAGCAGAAGTGCAAAGG - Intergenic
981155676 4:141432219-141432241 ACAGAATAGCAGAAAATCAATGG - Intergenic
981864270 4:149396411-149396433 ACTGATATGCAGAAATTACCAGG + Intergenic
982476844 4:155863289-155863311 ACTCAAAAGCACAAATTTAAGGG - Intronic
982604244 4:157493925-157493947 AAGTATAAGCAGATATTCAATGG + Intergenic
982634217 4:157872238-157872260 ACTAATAAGGAGAAATACATAGG - Intergenic
983409010 4:167372824-167372846 ACTGATAGGAAGAAAAACAAAGG + Intergenic
984019418 4:174466806-174466828 ATAGATAAGCTGAAATACAACGG + Intergenic
984562588 4:181288244-181288266 AATGAAAATCAGAGATTCAAAGG + Intergenic
985155780 4:186986061-186986083 ACAGATCAGCAGAAATTCTTTGG - Intergenic
986445242 5:7815651-7815673 AATGATAAACAGAAATTAATAGG + Intronic
987192504 5:15492761-15492783 ACTGGTGAGAACAAATTCAATGG - Intergenic
989093418 5:37758173-37758195 ACTGATAATCAGGATTGCAATGG - Intergenic
989374223 5:40743222-40743244 ACAAATGAGCAGAAATCCAAAGG + Intronic
989528176 5:42476699-42476721 ACTGGCCAACAGAAATTCAAAGG + Intronic
990337912 5:54793290-54793312 ACTGATGACTAGAAAGTCAATGG + Intergenic
991132942 5:63146297-63146319 ACTGATAAGCAAAATTTGCAAGG + Intergenic
991477556 5:67039343-67039365 ACTGCTAAGCAGAAATTCAATGG - Intronic
991498234 5:67249246-67249268 ACTCATAAAAAGAAATGCAAAGG - Intergenic
993206780 5:84891727-84891749 ACTGATAACAAAAAATTCAAAGG - Intergenic
994362481 5:98868467-98868489 ACTAATAATCAGAAAGTCTAAGG + Intronic
995638593 5:114225273-114225295 ACTGATGAGTAGCAAGTCAAAGG + Intergenic
996043231 5:118840736-118840758 ACAAATAAACAGAAATTCACTGG - Exonic
996364714 5:122688878-122688900 TCTTATAACCATAAATTCAATGG - Intergenic
996620449 5:125495578-125495600 AATGATAAGGAGAAATACATGGG - Intergenic
996809929 5:127505391-127505413 AGAGATAAGCAGAAGTTAAAAGG + Intergenic
997831872 5:137157377-137157399 ACTCAGATGCAAAAATTCAAAGG - Intronic
998185917 5:139980077-139980099 AGTGATAAGCAGAAATAGCATGG - Intronic
999485108 5:151987388-151987410 ACTGATAAAAAGAAATTGAAGGG - Intergenic
999527237 5:152420852-152420874 ACCCTTAAGCAGAAATCCAAAGG - Intronic
1000559213 5:162765160-162765182 ACTGATATGCAGAAGTTCCTAGG - Intergenic
1003783382 6:9455364-9455386 TCTGATAAGCATAAATCCATGGG - Intergenic
1005739559 6:28777536-28777558 AGTGCTAAGCAGAAATTCACAGG - Intergenic
1006465956 6:34195121-34195143 ACTGAGAAGCAGAAATCCAGAGG + Intergenic
1007226856 6:40321201-40321223 ACTTATAAACAGAGAATCAAGGG - Intergenic
1007809887 6:44478262-44478284 ACTCTTAAGCAGAAATGCCAAGG + Intergenic
1008259226 6:49344244-49344266 ACTGATTAGCTGAAAGTCAAGGG + Intergenic
1008815789 6:55564001-55564023 AATGCTAAGCAGAAATGGAAAGG + Intronic
1009847058 6:69146971-69146993 ACTGATAAGCAGAAATTCAAAGG - Intronic
1010220322 6:73443137-73443159 ACTGACATCCAGAAATCCAATGG - Intronic
1010440076 6:75883832-75883854 ACTGATAAGGAAAAATTCGCTGG - Intronic
1010539389 6:77072221-77072243 ACTAATATGTAGAAATACAAAGG + Intergenic
1010559955 6:77336623-77336645 ACTGATTCTGAGAAATTCAAAGG - Intergenic
1011855275 6:91682200-91682222 ACGGATGAGCAGAAAATCATAGG - Intergenic
1012719006 6:102717327-102717349 ATCCATAGGCAGAAATTCAAAGG + Intergenic
1012756132 6:103232680-103232702 ACTGATAAGCAGCATGTAAATGG + Intergenic
1013830750 6:114269715-114269737 GCTGATAACCAGAAATTGTATGG - Intronic
1015427289 6:133086301-133086323 AATGATGATCAGAAAGTCAAAGG - Intergenic
1015785429 6:136918107-136918129 ACTGACAAGCAAAAATAAAAAGG - Intergenic
1016493626 6:144634598-144634620 ACTGAAATGCACAATTTCAATGG - Intronic
1017248939 6:152259235-152259257 ATCCATAAGCAGGAATTCAAAGG - Intronic
1018877436 6:167836053-167836075 ACTGATAACTAAAAATTAAAAGG - Intronic
1020524023 7:9235334-9235356 CATGAAAGGCAGAAATTCAATGG + Intergenic
1021942474 7:25691464-25691486 GCTGATAAGGAGAAACTCATTGG - Intergenic
1022894641 7:34737686-34737708 ACTGAGAAGAAGCAATTCATAGG - Intronic
1022993300 7:35729347-35729369 ACTGAAAAGCAGAAAGTGATGGG + Intergenic
1024222711 7:47301007-47301029 ACTGAATAGCAGAATTTCAGTGG + Intronic
1024624373 7:51192039-51192061 CCTGAGAAGCAGGAAGTCAAGGG + Intronic
1026253678 7:68692335-68692357 ACTGAGAACCAGAAAAACAAAGG - Intergenic
1027352924 7:77330028-77330050 ACTGAAAAGCAGAAAGTTTAAGG - Intronic
1028026115 7:85842977-85842999 ACTGATATGCAGAATTTATAAGG - Intergenic
1028171797 7:87606120-87606142 ATGGATAAGAAAAAATTCAAAGG + Intronic
1029042363 7:97590282-97590304 AATGAAAAGGAGAAATTGAAAGG - Intergenic
1029261359 7:99304882-99304904 ACTGTTAAGAAGAAATTGAAAGG + Intergenic
1029340233 7:99936888-99936910 TCTGAGATGCAGCAATTCAAAGG - Intergenic
1030543564 7:110863881-110863903 ACTGATAAGCCCAATATCAATGG + Intronic
1030663140 7:112244510-112244532 ACTGATACGCAGAATGTCAATGG - Intronic
1031505985 7:122583441-122583463 CCTTTTAAGAAGAAATTCAAGGG - Intronic
1033815300 7:145063701-145063723 AGTGATAACAACAAATTCAAAGG + Intergenic
1034442191 7:151091471-151091493 AGTGAAAAGCAGACAATCAAAGG + Intronic
1035193007 7:157188917-157188939 AGTGTTAAACAGAAATTAAATGG - Intronic
1036008173 8:4691219-4691241 GCTGGTGAGCAGAAATTAAATGG + Intronic
1036468853 8:9031337-9031359 GCTGAAAAGCAGAAATTCATTGG - Exonic
1037268339 8:17094884-17094906 ACTGTTAAGGAGAAATTAAGAGG - Intronic
1038109230 8:24476623-24476645 ACTAATAAGCAAAAATCCACGGG + Intronic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1041136010 8:54759977-54759999 AGGGGCAAGCAGAAATTCAAGGG + Intergenic
1041529494 8:58848492-58848514 ACAGAAAAGCAGAAAGTAAAAGG + Intronic
1043277615 8:78419557-78419579 ACTGAAAGGCAGAATTTAAAAGG - Intergenic
1044970808 8:97617583-97617605 ATTGATAAGATGAAAATCAACGG - Intergenic
1045363425 8:101453814-101453836 ACTGAAAAACAGAAAATTAAAGG - Intergenic
1045744121 8:105396947-105396969 ACATGTAATCAGAAATTCAATGG - Intronic
1047891681 8:129318793-129318815 ATTGATAAGGAGAAAAACAATGG + Intergenic
1049126544 8:140794468-140794490 ACTGATTAGAATGAATTCAAGGG - Intronic
1050392557 9:5160764-5160786 ACTGATACGCAGAAATTAAAAGG + Intronic
1052373231 9:27689478-27689500 ACTGAGAAGCCCAATTTCAAAGG - Intergenic
1052475836 9:28957813-28957835 ACTGGTAAGTGGAAATTCTAGGG - Intergenic
1052496125 9:29227083-29227105 ACAGTTAAGCAGAAAAACAAAGG - Intergenic
1052614212 9:30817288-30817310 ACTGAAAAGAGGAAATACAATGG + Intergenic
1053728811 9:41031441-41031463 ACTAATAAGAAGAAAATGAATGG - Intergenic
1054699697 9:68400642-68400664 ACTAATAAGAAGAAAATGAATGG + Intronic
1054979403 9:71187129-71187151 ACTGTTAAAAAGATATTCAAAGG - Intronic
1055696091 9:78885985-78886007 ACTTACAAGAAGAAACTCAATGG - Intergenic
1055907762 9:81314015-81314037 AATTATAACCAGAAAATCAAAGG + Intergenic
1056070748 9:82984098-82984120 ACTGCTCAACAGAAATACAATGG + Intronic
1056132585 9:83600748-83600770 AGTGACAAGGAGCAATTCAAAGG + Intergenic
1058235846 9:102488500-102488522 ACTGATACCAAGAAATACAAAGG + Intergenic
1059118894 9:111623808-111623830 CCTTATATGAAGAAATTCAATGG + Intergenic
1060645251 9:125273293-125273315 ACTAATAAGCAGAACTGCAATGG - Intronic
1186416550 X:9388317-9388339 ACTGTTAATCATAAATTCAAAGG + Intergenic
1186916666 X:14230226-14230248 ATTGCTAAACAGAATTTCAATGG + Intergenic
1187397872 X:18933821-18933843 AATGACAAGCAGAAACCCAAAGG + Intronic
1187631948 X:21183046-21183068 TAAGATAAGCAGATATTCAAAGG - Intergenic
1188441458 X:30218129-30218151 ACTCATGAGAAGAAATTGAAGGG - Intronic
1191653112 X:63563584-63563606 ACTGATAACCAGATAGTCGAGGG + Intergenic
1193459962 X:81778367-81778389 ACTGATAAACAGAAGGTCTAAGG - Intergenic
1193825266 X:86217516-86217538 AGTGATAAGTAGAAAATGAAAGG + Intronic
1194115451 X:89890957-89890979 AGTGATAAGAAGAAAATGAAGGG - Intergenic
1194531885 X:95059701-95059723 ACTGAAAACCAGAACTACAAAGG + Intergenic
1194662495 X:96642549-96642571 ACCCATAAGCAGAAATTCAGTGG - Intergenic
1195239685 X:102938493-102938515 AGTGATGAGTATAAATTCAAGGG + Exonic
1195636034 X:107117179-107117201 ACTTTTAAGCTGACATTCAAAGG + Intronic
1196262043 X:113594325-113594347 AAGGAAAGGCAGAAATTCAAAGG + Intergenic
1196636432 X:118008017-118008039 ACTGATAACCAGAAAGACAAAGG + Intronic
1197341289 X:125269036-125269058 TCTGATACACAGAAATTCAAAGG - Intergenic
1198363622 X:135919678-135919700 AATGGTAAGAAGAAATTGAAGGG + Intergenic
1199080464 X:143570926-143570948 AATGACAAGCAGAAAGTCACTGG - Intergenic
1199162625 X:144631763-144631785 GCTGATAAGCAGAAATTATAAGG + Intergenic
1199521677 X:148742579-148742601 ACAGAAAAACAGAAGTTCAATGG - Intronic
1200468245 Y:3548096-3548118 AGTGATAAGAAGAAAATGAAGGG - Intergenic
1201558947 Y:15294439-15294461 ACTGAAAAGCCAAAATTAAAAGG + Intergenic
1201954233 Y:19604516-19604538 AATGATAAGTAAAACTTCAATGG + Intergenic
1202585157 Y:26415941-26415963 ATTGGAAAGGAGAAATTCAAAGG - Intergenic