ID: 1009847456

View in Genome Browser
Species Human (GRCh38)
Location 6:69151400-69151422
Sequence TGGGGGAGCACAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 2, 1: 2, 2: 25, 3: 77, 4: 325}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009847456_1009847466 20 Left 1009847456 6:69151400-69151422 CCCACAATCACTGTGCTCCCCCA 0: 2
1: 2
2: 25
3: 77
4: 325
Right 1009847466 6:69151443-69151465 CTGAACCACATGGTTGCTGCTGG No data
1009847456_1009847469 28 Left 1009847456 6:69151400-69151422 CCCACAATCACTGTGCTCCCCCA 0: 2
1: 2
2: 25
3: 77
4: 325
Right 1009847469 6:69151451-69151473 CATGGTTGCTGCTGGAGAATGGG 0: 1
1: 0
2: 4
3: 36
4: 264
1009847456_1009847468 27 Left 1009847456 6:69151400-69151422 CCCACAATCACTGTGCTCCCCCA 0: 2
1: 2
2: 25
3: 77
4: 325
Right 1009847468 6:69151450-69151472 ACATGGTTGCTGCTGGAGAATGG 0: 1
1: 0
2: 2
3: 29
4: 311
1009847456_1009847470 29 Left 1009847456 6:69151400-69151422 CCCACAATCACTGTGCTCCCCCA 0: 2
1: 2
2: 25
3: 77
4: 325
Right 1009847470 6:69151452-69151474 ATGGTTGCTGCTGGAGAATGGGG 0: 1
1: 1
2: 4
3: 44
4: 356
1009847456_1009847471 30 Left 1009847456 6:69151400-69151422 CCCACAATCACTGTGCTCCCCCA 0: 2
1: 2
2: 25
3: 77
4: 325
Right 1009847471 6:69151453-69151475 TGGTTGCTGCTGGAGAATGGGGG 0: 1
1: 1
2: 5
3: 49
4: 388
1009847456_1009847465 10 Left 1009847456 6:69151400-69151422 CCCACAATCACTGTGCTCCCCCA 0: 2
1: 2
2: 25
3: 77
4: 325
Right 1009847465 6:69151433-69151455 TACAGATTCTCTGAACCACATGG 0: 1
1: 0
2: 1
3: 15
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009847456 Original CRISPR TGGGGGAGCACAGTGATTGT GGG (reversed) Intronic