ID: 1009847497

View in Genome Browser
Species Human (GRCh38)
Location 6:69151802-69151824
Sequence CTAAAATTAAAGATGAGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 25350
Summary {0: 5, 1: 256, 2: 5213, 3: 8413, 4: 11463}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009847497_1009847506 16 Left 1009847497 6:69151802-69151824 CCAAATCTCATCTTTAATTTTAG 0: 5
1: 256
2: 5213
3: 8413
4: 11463
Right 1009847506 6:69151841-69151863 GTGCCATGGGAGGGACCCAGTGG 0: 11
1: 360
2: 1109
3: 2975
4: 5067
1009847497_1009847507 17 Left 1009847497 6:69151802-69151824 CCAAATCTCATCTTTAATTTTAG 0: 5
1: 256
2: 5213
3: 8413
4: 11463
Right 1009847507 6:69151842-69151864 TGCCATGGGAGGGACCCAGTGGG 0: 16
1: 633
2: 1409
3: 3455
4: 5303
1009847497_1009847502 7 Left 1009847497 6:69151802-69151824 CCAAATCTCATCTTTAATTTTAG 0: 5
1: 256
2: 5213
3: 8413
4: 11463
Right 1009847502 6:69151832-69151854 AGTCCCCATGTGCCATGGGAGGG No data
1009847497_1009847509 20 Left 1009847497 6:69151802-69151824 CCAAATCTCATCTTTAATTTTAG 0: 5
1: 256
2: 5213
3: 8413
4: 11463
Right 1009847509 6:69151845-69151867 CATGGGAGGGACCCAGTGGGAGG 0: 530
1: 1103
2: 2381
3: 3775
4: 4654
1009847497_1009847499 2 Left 1009847497 6:69151802-69151824 CCAAATCTCATCTTTAATTTTAG 0: 5
1: 256
2: 5213
3: 8413
4: 11463
Right 1009847499 6:69151827-69151849 CCTATAGTCCCCATGTGCCATGG No data
1009847497_1009847501 6 Left 1009847497 6:69151802-69151824 CCAAATCTCATCTTTAATTTTAG 0: 5
1: 256
2: 5213
3: 8413
4: 11463
Right 1009847501 6:69151831-69151853 TAGTCCCCATGTGCCATGGGAGG 0: 2
1: 19
2: 515
3: 1679
4: 3419
1009847497_1009847500 3 Left 1009847497 6:69151802-69151824 CCAAATCTCATCTTTAATTTTAG 0: 5
1: 256
2: 5213
3: 8413
4: 11463
Right 1009847500 6:69151828-69151850 CTATAGTCCCCATGTGCCATGGG 0: 1
1: 1
2: 48
3: 595
4: 1814

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009847497 Original CRISPR CTAAAATTAAAGATGAGATT TGG (reversed) Intronic
Too many off-targets to display for this crispr