ID: 1009847500

View in Genome Browser
Species Human (GRCh38)
Location 6:69151828-69151850
Sequence CTATAGTCCCCATGTGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2459
Summary {0: 1, 1: 1, 2: 48, 3: 595, 4: 1814}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009847497_1009847500 3 Left 1009847497 6:69151802-69151824 CCAAATCTCATCTTTAATTTTAG 0: 5
1: 256
2: 5213
3: 8413
4: 11463
Right 1009847500 6:69151828-69151850 CTATAGTCCCCATGTGCCATGGG 0: 1
1: 1
2: 48
3: 595
4: 1814
1009847496_1009847500 7 Left 1009847496 6:69151798-69151820 CCATCCAAATCTCATCTTTAATT 0: 13
1: 707
2: 9538
3: 14453
4: 12525
Right 1009847500 6:69151828-69151850 CTATAGTCCCCATGTGCCATGGG 0: 1
1: 1
2: 48
3: 595
4: 1814

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009847500 Original CRISPR CTATAGTCCCCATGTGCCAT GGG Intronic
Too many off-targets to display for this crispr