ID: 1009848552

View in Genome Browser
Species Human (GRCh38)
Location 6:69165390-69165412
Sequence TTGGGGGGGATGGCTGCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 115}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009848552_1009848562 11 Left 1009848552 6:69165390-69165412 CCCGCGGCAGCCATCCCCCCCAA 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1009848562 6:69165424-69165446 ACCCCGGCAAAACAATTGTTTGG 0: 1
1: 0
2: 0
3: 3
4: 40
1009848552_1009848560 -5 Left 1009848552 6:69165390-69165412 CCCGCGGCAGCCATCCCCCCCAA 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1009848560 6:69165408-69165430 CCCAACTTCACTTTACACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009848552 Original CRISPR TTGGGGGGGATGGCTGCCGC GGG (reversed) Intronic
900116546 1:1031605-1031627 GTGGGGGGCCTGGCTGCCCCAGG - Intronic
900184255 1:1325563-1325585 GTGTGGGGGATGGCTGCTCCTGG - Intronic
900645681 1:3707693-3707715 TTGGAGGGGATGACAGGCGCCGG - Exonic
901086685 1:6615061-6615083 TCGCGGGGGGCGGCTGCCGCGGG + Intronic
901193503 1:7426386-7426408 TTGGGGGAGATCACTACCGCTGG - Intronic
901201552 1:7470102-7470124 TGGGGAGGGATGGCTCCCCCAGG - Intronic
902517991 1:17000180-17000202 TGGGGGGGCATGGCTGGGGCTGG - Intronic
905900031 1:41575326-41575348 TTGGTGGGGATGGGTGATGCTGG - Intronic
906129111 1:43445478-43445500 TTGGGGGGGATGGCAGTTCCAGG - Intronic
907406280 1:54255392-54255414 CTGGGTGGGAAGGCTGCTGCTGG + Intronic
911435214 1:97846972-97846994 GAGGGAGGGATGGCTGCCCCAGG + Intronic
911844571 1:102734703-102734725 TTGAAGGGGATGGCTGCTGCCGG + Intergenic
1064572906 10:16714367-16714389 TTGGGAGGGAGGGCTGCTACTGG + Intronic
1065877905 10:30013038-30013060 CTGGGGGCGATGACTGCAGCCGG + Exonic
1067337410 10:45376344-45376366 TTGGGGGTGGGGGCTACCGCAGG + Intronic
1075552529 10:123402583-123402605 TGGAAGGGGATGGCTGCCTCAGG - Intergenic
1075883315 10:125873696-125873718 TTGGGTGGGATAGCTGCCTTAGG - Intronic
1076702876 10:132283397-132283419 GAGGGGGGCGTGGCTGCCGCTGG - Intronic
1078664121 11:13310283-13310305 GTGCGGGGGATGGATGCAGCGGG + Intronic
1083620872 11:64048804-64048826 TTGGTGGGGATAGCAGCCCCTGG - Intronic
1084494819 11:69497689-69497711 TTGGGGTGGATGTCTGCCCCTGG + Intergenic
1084527468 11:69705777-69705799 GTGGGGGCGATGGCAGCCTCTGG + Intergenic
1086570528 11:88278883-88278905 TTGAGGGGGATGGATGAAGCTGG + Intergenic
1087820428 11:102705425-102705447 TTGGGGAGGAGGGCTGGCACAGG - Intronic
1088495763 11:110430112-110430134 CCGCGGGCGATGGCTGCCGCTGG + Exonic
1095206336 12:39443507-39443529 GGGGGAGGGATGCCTGCCGCCGG + Intergenic
1102454478 12:113063239-113063261 GTGAGGGGGTTGGCTGCCACTGG + Intronic
1103572593 12:121854928-121854950 TTGGGGGTAATGGCTGAAGCTGG - Intronic
1108695515 13:52899366-52899388 TTGTGGGGGAGGGCAGCTGCTGG + Intergenic
1108695692 13:52900588-52900610 TTGTGGGGGAGGGCAGCTGCTGG + Intergenic
1112516037 13:100054152-100054174 TTGGGGGGTAGGGCTGAGGCAGG - Intergenic
1112722399 13:102259591-102259613 ATGGGGGGGAGGGCTCCCACAGG - Intronic
1113656131 13:112068623-112068645 TGGGGCGGGCGGGCTGCCGCTGG - Exonic
1118416398 14:65541452-65541474 TCGGAGGGGATTGCTGCTGCTGG + Intronic
1119180980 14:72605141-72605163 TGGAGTGGAATGGCTGCCGCTGG - Intergenic
1119681683 14:76597032-76597054 CTGGGGAGGATGGCTGGTGCTGG + Intergenic
1121264000 14:92587335-92587357 TTGTGGGTAATGGCTGCCCCAGG - Intronic
1123208231 14:106734715-106734737 GTGGAGGGGATGGTGGCCGCCGG + Intergenic
1128751588 15:70154133-70154155 TTGGGGGAGGGGGCTGCTGCAGG - Intergenic
1129758654 15:78113956-78113978 TTTTGTGGGATGGCTGCAGCAGG + Intronic
1132664369 16:1074785-1074807 ATGGGAGGGATGGATGCTGCTGG + Intergenic
1132734073 16:1377016-1377038 TTGGGGGGGCTGGGTGTGGCGGG - Intronic
1134670946 16:16054601-16054623 TTGGGTGGGATGGGTGAGGCAGG + Intronic
1136227951 16:28871806-28871828 CTGGGGGAGATGGATGCCGAGGG - Exonic
1136610851 16:31364039-31364061 TTGGGGTGGAGGGCGGCTGCAGG - Intronic
1137676201 16:50304987-50305009 TTGGAGGAGGTGGCTGCAGCAGG - Intronic
1141982346 16:87558412-87558434 TTGAGGGGCATGGCTGCTCCAGG - Intergenic
1142216059 16:88830510-88830532 TTGAAGGGGATGGCTGCCTCTGG + Intronic
1142266385 16:89065725-89065747 CTTGGGGGCATGGCTGCCGTGGG + Intergenic
1152033837 17:77859652-77859674 TGAGGGGAGATGGCTGCAGCTGG - Intergenic
1152567036 17:81104991-81105013 TTGGGGGAGATCCCTGCCGTTGG - Intronic
1152880960 17:82814954-82814976 TCAGGGGGGATGTCTGGCGCTGG + Intronic
1153887000 18:9475839-9475861 GTGGGGGGCGTGGCTGCCCCTGG + Intronic
1154172640 18:12062351-12062373 TTGGGGGGGGGGGCTGAGGCAGG - Intergenic
1155245461 18:23904486-23904508 TTTGGGGGGATGTCAGCTGCTGG + Intronic
1158120964 18:54047980-54048002 TTGGGGTGGGTGGGTGCCGTGGG + Intergenic
1161035043 19:2079811-2079833 TTGGGGTGGACAGCTGCCCCTGG - Intronic
1163153663 19:15428805-15428827 TTGGGGGCGATGGTGGCTGCTGG + Intronic
1166217484 19:41345015-41345037 TTGGGGAGGATGGGTGCCACAGG - Intronic
1166891954 19:45999426-45999448 GTGGGGCGGAGGGCTGCTGCAGG + Intronic
1168283767 19:55320512-55320534 TTTGGGGGGATCGCCGCTGCAGG - Intronic
926700700 2:15801293-15801315 CTGGTGGGGATGGCGGCCACAGG + Intergenic
929501251 2:42493536-42493558 TTGGGGTGGGGGGCTGCAGCGGG - Exonic
935059139 2:99593077-99593099 TTGGGACGGTAGGCTGCCGCAGG - Intronic
1172379527 20:34476461-34476483 CCGCGGGCGATGGCTGCCGCTGG - Intronic
1173923781 20:46765560-46765582 TTGGGGGTGATGCCAGCCCCAGG - Intergenic
1175390520 20:58624429-58624451 TTGTGGAGGGTGGCTGCCCCTGG - Intergenic
1175934054 20:62506964-62506986 ATGGCGGGGATGGCGGCCGTGGG + Intergenic
1179411525 21:41167307-41167329 GTGGGGGGCGTGGCTGCTGCTGG - Intergenic
1181626290 22:24124424-24124446 TTGGGAGGGAGGGCAGCCTCAGG - Intronic
1184330380 22:43823503-43823525 GTGGGGGGCCTGGCTGCAGCTGG - Intergenic
1184391780 22:44207247-44207269 TTGGTGGGGAGGGCTGGGGCTGG + Exonic
950654889 3:14430452-14430474 TTGAGGGAGATGGCTACCACTGG + Intronic
952513361 3:34078944-34078966 TTGGTGGGGGTGGCTGAGGCCGG - Intergenic
953235053 3:41098905-41098927 TTGGGGAGGAGGGCTGCAGAGGG + Intergenic
954131984 3:48565535-48565557 TTGGCTGGGATGGCTGCCCATGG - Intronic
954424374 3:50435648-50435670 GTGGGGGGGTTGGGTGCTGCTGG + Intronic
966866663 3:184261906-184261928 TGGGGCGGGAAGGCGGCCGCAGG + Intronic
968649442 4:1754639-1754661 ATGGGAGAGATAGCTGCCGCTGG + Intergenic
969271903 4:6108629-6108651 GTGGCGGGGAGGGCTGCTGCAGG - Intronic
971321128 4:25606887-25606909 TTGGGAGGGATGGCTGGGGAGGG + Intergenic
971582357 4:28358195-28358217 TGGTGGGGGATGGCTGCTACTGG - Intergenic
972671151 4:41214759-41214781 TTGGGGAGGGTGCCTCCCGCAGG - Intronic
976002184 4:80386511-80386533 GTGGGGGGGGGGGGTGCCGCCGG + Intronic
981550473 4:145937282-145937304 TTGGCGTGTGTGGCTGCCGCCGG + Intronic
985713766 5:1444897-1444919 TTGGGGGTGGTGGCGGGCGCGGG - Intronic
985795698 5:1960337-1960359 TTTGGGTGGATGCCTCCCGCTGG - Intergenic
985923408 5:2996937-2996959 TTGGGAGACATGGCTGCCCCGGG + Intergenic
987067330 5:14303018-14303040 AGGGTTGGGATGGCTGCCGCAGG + Intronic
987067366 5:14303162-14303184 AGGGTTGGGATGGCTGCCGCAGG + Intronic
988607576 5:32692841-32692863 TTGGGGGTGGTGGCTCACGCCGG + Intronic
992167156 5:74065595-74065617 TTGGGGGGGGTGGTTGCAGGAGG - Intergenic
997965423 5:138352678-138352700 TGGGGGGGAACGGCGGCCGCGGG + Exonic
998225221 5:140321733-140321755 TTGGGGTGGATGACTCCAGCTGG - Intergenic
1001101859 5:168820940-168820962 TTGGGGGGGACGGCTGGTGGTGG - Intronic
1002417998 5:179130703-179130725 GTGTGGGGGGTGGCTGCTGCGGG + Intronic
1002562267 5:180090489-180090511 GTGGGGAGGAGCGCTGCCGCCGG + Intergenic
1003637305 6:7844614-7844636 TTGGTGGGGATGGCTGCGGGTGG - Intronic
1003860861 6:10320483-10320505 TTGGGGAGGATGGCGGAGGCTGG - Intergenic
1007473689 6:42105951-42105973 TTGGGTGGTATGGCTGGCTCAGG + Exonic
1007637449 6:43307932-43307954 CTGTGGGGCATGGCTCCCGCTGG - Intronic
1009848552 6:69165390-69165412 TTGGGGGGGATGGCTGCCGCGGG - Intronic
1017881920 6:158568017-158568039 TTGGAGGTGATGGCAGCAGCTGG + Intronic
1019095694 6:169577413-169577435 TTGGCGGGTATGGCTGCGTCGGG + Intronic
1020465829 7:8477694-8477716 TGGGGGAGGATGGCTGCATCAGG + Intronic
1023633348 7:42184739-42184761 CTGGGGGTGAGGGCTGCCCCAGG - Intronic
1024558091 7:50621105-50621127 TTGGGGCTGGTGGCTGCCCCAGG - Intronic
1035069066 7:156127670-156127692 TTCGGGGGGTTGGCTACCCCAGG - Intergenic
1035304345 7:157921591-157921613 TTGTGGGAGTGGGCTGCCGCAGG + Intronic
1036636985 8:10557910-10557932 TTGGAAGGGATGGCTGACTCTGG - Intergenic
1036752722 8:11453587-11453609 GTGGAGGGGAGGGCTGCAGCAGG + Intronic
1037417599 8:18667985-18668007 TTGGTGGGTGTGGCTTCCGCGGG - Intronic
1042226876 8:66521134-66521156 TTGGGGGGGTGGGCAGCAGCAGG + Intergenic
1044719236 8:95129757-95129779 TTGGAGGGGATGGCAGGGGCTGG + Intergenic
1046026583 8:108731219-108731241 TTGGGGGGGATGGGGGGCGGTGG - Intronic
1058985114 9:110202881-110202903 TTGGCTGAGATGGCTGCAGCTGG - Intronic
1060747548 9:126147464-126147486 TAGTGGGGGCTGGCTGCAGCAGG + Intergenic
1062208792 9:135351953-135351975 TTCAGGGGGGTGGCTGCAGCAGG - Intergenic
1192369261 X:70499825-70499847 TTGGGGCGGATCACTGCCCCTGG + Intronic
1193526605 X:82598375-82598397 TTGTGGGGTATGGCTGCAGGTGG - Intergenic
1197620578 X:128743233-128743255 TTGGTGGGGATGGCAGCTGGAGG + Intergenic