ID: 1009864045

View in Genome Browser
Species Human (GRCh38)
Location 6:69374419-69374441
Sequence CATTATATGATAAAGCTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009864045_1009864048 17 Left 1009864045 6:69374419-69374441 CCTGCAAGCTTTATCATATAATG 0: 1
1: 0
2: 0
3: 7
4: 111
Right 1009864048 6:69374459-69374481 GCCACTGACAGACTGCTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009864045 Original CRISPR CATTATATGATAAAGCTTGC AGG (reversed) Intronic
902487170 1:16756758-16756780 CATTAAATGGTAAATATTGCCGG + Intronic
905364691 1:37443918-37443940 CATTATAGAAAAAAGCTGGCTGG + Intergenic
906630109 1:47359810-47359832 CCTTATAAGATAAAGGTTTCAGG - Intronic
907345188 1:53771485-53771507 CACTATCTGATAAAACTTTCTGG + Intronic
908038076 1:60077458-60077480 AATTCTGTGATAAAGCTTGAAGG + Intergenic
908642034 1:66234936-66234958 CATTATATGTTAAAATTTGTAGG - Intronic
909918301 1:81348192-81348214 CATTAGATGTTAAGGCTTGGGGG - Intronic
909932331 1:81510946-81510968 GTTAATATGATTAAGCTTGCAGG - Intronic
911870941 1:103097645-103097667 CATTATATGCTAAAGGTAGTTGG - Intronic
914988977 1:152482052-152482074 CATTAAATTTTACAGCTTGCGGG + Intergenic
915847778 1:159286294-159286316 AATTAAATGATAAAGGTTGATGG - Intergenic
916956302 1:169839502-169839524 CATCATATGAAAAAGCTATCAGG - Intronic
918997626 1:191782452-191782474 CATTATAGGCTAGAGGTTGCAGG + Intergenic
921199245 1:212789719-212789741 AATTATAAGATAAAGTTTACAGG - Intronic
924392606 1:243579821-243579843 CAATATATGATAAAGTATACAGG + Intronic
1067446409 10:46350585-46350607 CATTGTAAGATAATGCTGGCTGG - Intergenic
1068316203 10:55346483-55346505 CATTCTATGATAAATTTTGCTGG - Intronic
1070134692 10:73682705-73682727 CATTGTAAGATAATGCTGGCTGG + Exonic
1071607047 10:87001703-87001725 CATTATAAGATAATGCTGGCTGG - Intergenic
1071985840 10:91049423-91049445 CATGATATGAAAAAGCTACCTGG + Intergenic
1073844229 10:107534781-107534803 AATTATATCATAAAGCTAGTTGG - Intergenic
1074622560 10:115140482-115140504 AATTGTATGCTGAAGCTTGCTGG - Intronic
1078917229 11:15790139-15790161 CAATATATGTTAAAACTAGCAGG + Intergenic
1078962947 11:16300810-16300832 CATTAAATGTTAAAGCCTGTGGG + Intronic
1080110228 11:28558484-28558506 AATGATATGATAAAGATTACAGG + Intergenic
1088641813 11:111879935-111879957 CAATATATGCAAAAGCTTGATGG + Intronic
1089886907 11:121834277-121834299 CACTAAAATATAAAGCTTGCTGG + Intergenic
1090994857 11:131856861-131856883 CAAGCTATGATAAAGCTTTCTGG - Intronic
1093390837 12:18618807-18618829 CCTAAAATGATAAATCTTGCTGG + Intronic
1093832510 12:23780842-23780864 CATTATAAGATAGAGTATGCTGG + Intronic
1096278454 12:50230871-50230893 CATTATAAGAAAAAACTGGCCGG - Intronic
1097405695 12:59186753-59186775 CATTATATCATTAAGCATGTTGG - Intergenic
1098747072 12:74252231-74252253 CATTATATGGTAAATCTTTCAGG + Intergenic
1099647552 12:85378738-85378760 AATTATATGGAAAAGCTGGCAGG + Intergenic
1100559197 12:95730897-95730919 AATTAAATGATAGAGGTTGCTGG + Intronic
1100898961 12:99216396-99216418 AATGATTTAATAAAGCTTGCAGG - Intronic
1101290832 12:103366974-103366996 CATTATATGAAAAAGATTCTTGG + Intronic
1101869687 12:108555240-108555262 AATTACATTTTAAAGCTTGCTGG - Intronic
1106277853 13:28231462-28231484 CATTTTATGAGAAAGCTTTAAGG + Intronic
1109475301 13:62873436-62873458 CATTTTATGATAGAACTTTCTGG + Intergenic
1111835731 13:93386302-93386324 CATTATTTTAAAAAGCTTGAAGG - Intronic
1118177881 14:63460976-63460998 CATTAGAAGATAAAGCATGAGGG - Intronic
1118249304 14:64143467-64143489 CAGGATATGACAAAGCTTCCTGG - Intronic
1118796588 14:69151300-69151322 CATTTTATGATAAACCTTCTGGG - Intronic
1120479046 14:85025242-85025264 CATTAAATGATAAGACTTTCAGG - Intergenic
1132426010 15:101718004-101718026 AAATATTTGATAAAACTTGCAGG + Intronic
1137959505 16:52867893-52867915 CATTATATCAAAAAGCTTGTAGG - Intergenic
1144134851 17:12283929-12283951 CATTATATGACATAGGATGCAGG - Intergenic
1146402946 17:32514458-32514480 CATTTTCAGATAAAGATTGCTGG - Intronic
1150917761 17:69453873-69453895 CATTATATTTTAAAGCTTCCCGG + Intronic
1151440260 17:74124078-74124100 CTTTCTATGATACAGCATGCGGG - Intergenic
1153456763 18:5291481-5291503 CATTAAATGTTAAGGCTTGAGGG + Exonic
1156645234 18:39153730-39153752 CATTAAGTAATAAAACTTGCAGG + Intergenic
1162207628 19:9067618-9067640 CATTATATGGCAAAGCTGGTGGG - Intergenic
1166207846 19:41284352-41284374 CAATATATGATAAAAAGTGCAGG - Intronic
1202704037 1_KI270713v1_random:7482-7504 CATTAAATGGTAAATATTGCCGG - Intergenic
926830978 2:16961467-16961489 CCTTATATGACAAAGCTTAATGG - Intergenic
929819983 2:45265374-45265396 CATCATATGAATAAGATTGCAGG - Intergenic
933628784 2:84633069-84633091 CATTCTATGAAGAAGCCTGCTGG - Intronic
937409457 2:121660342-121660364 CATAAAATCATAAAGCTTACAGG - Intergenic
937649885 2:124307931-124307953 CAATATATGACAAAGCTGGCGGG + Intronic
937935964 2:127245280-127245302 CATTTTTTCAAAAAGCTTGCTGG - Intergenic
941867920 2:170353983-170354005 CATTATCTGATATAACTAGCAGG + Intronic
944396753 2:199276705-199276727 CAATTTATGAAAAAGCTGGCAGG + Intronic
946832700 2:223742280-223742302 CCTTATAAGATATAGCTAGCCGG - Intergenic
1169639760 20:7737980-7738002 CATTACATAACAAAACTTGCAGG - Intergenic
1170834738 20:19874522-19874544 CATTATCTCATAATGCTTCCTGG + Intergenic
1173178246 20:40781760-40781782 CTTAATATGATCAATCTTGCCGG + Intergenic
1174138962 20:48399739-48399761 CAATAATTGATAAAGCTGGCAGG - Intergenic
1178331087 21:31692095-31692117 CTTTATATAACAAAGCTTGGAGG - Intronic
1183424051 22:37728485-37728507 TATTAAATGATCAAGCTTACTGG - Intronic
950906139 3:16540178-16540200 AATTATATGATAAACCTTTCAGG + Intergenic
955095084 3:55789175-55789197 CATTATAGGATAAAATTGGCGGG - Intronic
956676904 3:71743582-71743604 AATTCTATGATAAAGCCTACTGG - Intronic
958776261 3:98486880-98486902 AATTAGAAGATAAAGCTTGAAGG + Intergenic
960634111 3:119766991-119767013 CATTATAAGTAAAAGATTGCCGG - Exonic
960934017 3:122885158-122885180 TAGAATATGATAAAGCTTGATGG - Intergenic
966742495 3:183247185-183247207 CACTATTAGATAAAACTTGCAGG - Intronic
967512750 3:190331286-190331308 AAATATTTGATAAAGCTTGTGGG - Intronic
970092210 4:12422473-12422495 CATTAAATGATAACTATTGCAGG + Intergenic
970752487 4:19381306-19381328 CACTATATGAGAAAGTTTCCAGG + Intergenic
973038515 4:45440042-45440064 CATTAAATAATAAAGCAAGCAGG + Intergenic
984552511 4:181177557-181177579 CACTATCTGGCAAAGCTTGCTGG - Intergenic
984797365 4:183675437-183675459 CATTGTGTCATAAAGCTTTCTGG + Intronic
986406529 5:7431023-7431045 CTCTCTATGAAAAAGCTTGCTGG - Intronic
987388882 5:17356820-17356842 TTTTATATGATAAAGCTTTAAGG + Intergenic
993641001 5:90405377-90405399 TATTATGTGATAAAACTTGAAGG - Intronic
996694904 5:126383519-126383541 CATTACTTTATAAACCTTGCTGG + Intronic
996890201 5:128409979-128410001 TATTTCATGATAAAGCTTGTAGG - Intronic
999654209 5:153796797-153796819 CATTATATTATAAAACAAGCCGG - Intronic
999972153 5:156875586-156875608 CAACAAATGATAAAGCATGCAGG + Intergenic
1000334579 5:160232594-160232616 CATGAGATTAAAAAGCTTGCTGG + Intronic
1002832039 6:831012-831034 CATTATAAGATAAAGCCTCATGG - Intergenic
1004638699 6:17493380-17493402 CATTATATCCTAAAACTTGTTGG - Intronic
1004645587 6:17557537-17557559 AATTATAGTATAATGCTTGCAGG + Exonic
1005082232 6:21967859-21967881 CATCACATTTTAAAGCTTGCAGG - Intergenic
1009733456 6:67641512-67641534 CATAATATAATGAAGCTAGCAGG - Intergenic
1009864045 6:69374419-69374441 CATTATATGATAAAGCTTGCAGG - Intronic
1010675022 6:78733081-78733103 CTTTATTTAATAAAGGTTGCTGG + Intergenic
1014210101 6:118699599-118699621 CATTATATGTAAAAGATTTCTGG + Intronic
1014661989 6:124183731-124183753 AGTTATATGAAAAAACTTGCAGG - Intronic
1015407035 6:132849424-132849446 CAGTATATGTTAAAGGTTGAAGG - Intergenic
1015944301 6:138484240-138484262 CATTTTCAGAAAAAGCTTGCAGG + Intronic
1016355756 6:143216447-143216469 AATTATATGACAAAACTTTCAGG + Intronic
1018248887 6:161848371-161848393 CATTATATGATAATACATGAAGG - Intronic
1020927408 7:14348776-14348798 CCTTTTATTCTAAAGCTTGCAGG - Intronic
1022959986 7:35417397-35417419 CTTTATAAGAAAAGGCTTGCAGG - Intergenic
1028235883 7:88361170-88361192 TATTATATAATAAATGTTGCAGG + Intergenic
1040817429 8:51523610-51523632 CATGATATGAAAATGCTTTCAGG + Intronic
1046055911 8:109078020-109078042 AATAATATGATTAAACTTGCTGG - Intergenic
1047799712 8:128296189-128296211 TATAATAGTATAAAGCTTGCTGG + Intergenic
1051148155 9:14051717-14051739 CATTTTATGAAAAACCATGCTGG + Intergenic
1056920228 9:90781025-90781047 CACTTTGTGACAAAGCTTGCTGG - Intergenic
1058771215 9:108234210-108234232 CATTATATGAAAAAGATTATGGG + Intergenic
1059134263 9:111789385-111789407 CATTATATAATACAGTTTGTGGG - Intronic
1062143680 9:134976330-134976352 TATTATCTGAGAAAACTTGCTGG - Intergenic
1193719796 X:84973693-84973715 AATTATTTGTTAAAGCTTCCAGG - Intergenic
1198611310 X:138404085-138404107 TATTATAGGATAAGGATTGCAGG + Intergenic
1199930285 X:152511393-152511415 CAATATATGCTAAAGCTCACAGG + Intergenic