ID: 1009868266

View in Genome Browser
Species Human (GRCh38)
Location 6:69424942-69424964
Sequence CAGTCCTTCCGGGGGCTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009868258_1009868266 14 Left 1009868258 6:69424905-69424927 CCAGAGTCAAGGTAATTGTGATA No data
Right 1009868266 6:69424942-69424964 CAGTCCTTCCGGGGGCTGGGCGG No data
1009868255_1009868266 29 Left 1009868255 6:69424890-69424912 CCTGCCACATTCAGACCAGAGTC No data
Right 1009868266 6:69424942-69424964 CAGTCCTTCCGGGGGCTGGGCGG No data
1009868256_1009868266 25 Left 1009868256 6:69424894-69424916 CCACATTCAGACCAGAGTCAAGG No data
Right 1009868266 6:69424942-69424964 CAGTCCTTCCGGGGGCTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009868266 Original CRISPR CAGTCCTTCCGGGGGCTGGG CGG Intergenic
No off target data available for this crispr