ID: 1009868583

View in Genome Browser
Species Human (GRCh38)
Location 6:69428812-69428834
Sequence ATATATGGGGATTGAAGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009868583_1009868591 15 Left 1009868583 6:69428812-69428834 CCATATCTTCAATCCCCATATAT No data
Right 1009868591 6:69428850-69428872 AAGGAAAGCTCCTTGAGGACAGG No data
1009868583_1009868587 -4 Left 1009868583 6:69428812-69428834 CCATATCTTCAATCCCCATATAT No data
Right 1009868587 6:69428831-69428853 ATATTGCTGTTCCCTAGAGAAGG No data
1009868583_1009868593 24 Left 1009868583 6:69428812-69428834 CCATATCTTCAATCCCCATATAT No data
Right 1009868593 6:69428859-69428881 TCCTTGAGGACAGGGAATTTTGG No data
1009868583_1009868592 16 Left 1009868583 6:69428812-69428834 CCATATCTTCAATCCCCATATAT No data
Right 1009868592 6:69428851-69428873 AGGAAAGCTCCTTGAGGACAGGG No data
1009868583_1009868590 10 Left 1009868583 6:69428812-69428834 CCATATCTTCAATCCCCATATAT No data
Right 1009868590 6:69428845-69428867 TAGAGAAGGAAAGCTCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009868583 Original CRISPR ATATATGGGGATTGAAGATA TGG (reversed) Intergenic