ID: 1009868585

View in Genome Browser
Species Human (GRCh38)
Location 6:69428826-69428848
Sequence TCTAGGGAACAGCAATATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009868585_1009868593 10 Left 1009868585 6:69428826-69428848 CCCATATATTGCTGTTCCCTAGA No data
Right 1009868593 6:69428859-69428881 TCCTTGAGGACAGGGAATTTTGG No data
1009868585_1009868590 -4 Left 1009868585 6:69428826-69428848 CCCATATATTGCTGTTCCCTAGA No data
Right 1009868590 6:69428845-69428867 TAGAGAAGGAAAGCTCCTTGAGG No data
1009868585_1009868592 2 Left 1009868585 6:69428826-69428848 CCCATATATTGCTGTTCCCTAGA No data
Right 1009868592 6:69428851-69428873 AGGAAAGCTCCTTGAGGACAGGG No data
1009868585_1009868591 1 Left 1009868585 6:69428826-69428848 CCCATATATTGCTGTTCCCTAGA No data
Right 1009868591 6:69428850-69428872 AAGGAAAGCTCCTTGAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009868585 Original CRISPR TCTAGGGAACAGCAATATAT GGG (reversed) Intergenic
No off target data available for this crispr