ID: 1009868586

View in Genome Browser
Species Human (GRCh38)
Location 6:69428827-69428849
Sequence CTCTAGGGAACAGCAATATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009868586_1009868593 9 Left 1009868586 6:69428827-69428849 CCATATATTGCTGTTCCCTAGAG No data
Right 1009868593 6:69428859-69428881 TCCTTGAGGACAGGGAATTTTGG No data
1009868586_1009868592 1 Left 1009868586 6:69428827-69428849 CCATATATTGCTGTTCCCTAGAG No data
Right 1009868592 6:69428851-69428873 AGGAAAGCTCCTTGAGGACAGGG No data
1009868586_1009868591 0 Left 1009868586 6:69428827-69428849 CCATATATTGCTGTTCCCTAGAG No data
Right 1009868591 6:69428850-69428872 AAGGAAAGCTCCTTGAGGACAGG No data
1009868586_1009868590 -5 Left 1009868586 6:69428827-69428849 CCATATATTGCTGTTCCCTAGAG No data
Right 1009868590 6:69428845-69428867 TAGAGAAGGAAAGCTCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009868586 Original CRISPR CTCTAGGGAACAGCAATATA TGG (reversed) Intergenic