ID: 1009868587

View in Genome Browser
Species Human (GRCh38)
Location 6:69428831-69428853
Sequence ATATTGCTGTTCCCTAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009868583_1009868587 -4 Left 1009868583 6:69428812-69428834 CCATATCTTCAATCCCCATATAT No data
Right 1009868587 6:69428831-69428853 ATATTGCTGTTCCCTAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009868587 Original CRISPR ATATTGCTGTTCCCTAGAGA AGG Intergenic