ID: 1009868590

View in Genome Browser
Species Human (GRCh38)
Location 6:69428845-69428867
Sequence TAGAGAAGGAAAGCTCCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009868584_1009868590 -3 Left 1009868584 6:69428825-69428847 CCCCATATATTGCTGTTCCCTAG No data
Right 1009868590 6:69428845-69428867 TAGAGAAGGAAAGCTCCTTGAGG No data
1009868586_1009868590 -5 Left 1009868586 6:69428827-69428849 CCATATATTGCTGTTCCCTAGAG No data
Right 1009868590 6:69428845-69428867 TAGAGAAGGAAAGCTCCTTGAGG No data
1009868585_1009868590 -4 Left 1009868585 6:69428826-69428848 CCCATATATTGCTGTTCCCTAGA No data
Right 1009868590 6:69428845-69428867 TAGAGAAGGAAAGCTCCTTGAGG No data
1009868583_1009868590 10 Left 1009868583 6:69428812-69428834 CCATATCTTCAATCCCCATATAT No data
Right 1009868590 6:69428845-69428867 TAGAGAAGGAAAGCTCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009868590 Original CRISPR TAGAGAAGGAAAGCTCCTTG AGG Intergenic