ID: 1009868593

View in Genome Browser
Species Human (GRCh38)
Location 6:69428859-69428881
Sequence TCCTTGAGGACAGGGAATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009868586_1009868593 9 Left 1009868586 6:69428827-69428849 CCATATATTGCTGTTCCCTAGAG No data
Right 1009868593 6:69428859-69428881 TCCTTGAGGACAGGGAATTTTGG No data
1009868583_1009868593 24 Left 1009868583 6:69428812-69428834 CCATATCTTCAATCCCCATATAT No data
Right 1009868593 6:69428859-69428881 TCCTTGAGGACAGGGAATTTTGG No data
1009868584_1009868593 11 Left 1009868584 6:69428825-69428847 CCCCATATATTGCTGTTCCCTAG No data
Right 1009868593 6:69428859-69428881 TCCTTGAGGACAGGGAATTTTGG No data
1009868589_1009868593 -7 Left 1009868589 6:69428843-69428865 CCTAGAGAAGGAAAGCTCCTTGA No data
Right 1009868593 6:69428859-69428881 TCCTTGAGGACAGGGAATTTTGG No data
1009868585_1009868593 10 Left 1009868585 6:69428826-69428848 CCCATATATTGCTGTTCCCTAGA No data
Right 1009868593 6:69428859-69428881 TCCTTGAGGACAGGGAATTTTGG No data
1009868588_1009868593 -6 Left 1009868588 6:69428842-69428864 CCCTAGAGAAGGAAAGCTCCTTG No data
Right 1009868593 6:69428859-69428881 TCCTTGAGGACAGGGAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009868593 Original CRISPR TCCTTGAGGACAGGGAATTT TGG Intergenic