ID: 1009869598

View in Genome Browser
Species Human (GRCh38)
Location 6:69436988-69437010
Sequence TAAGGTAACATTCAAATCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009869598_1009869601 14 Left 1009869598 6:69436988-69437010 CCCTTGATTTGAATGTTACCTTA No data
Right 1009869601 6:69437025-69437047 TGTTTTGTTGTTGTTTTCACTGG No data
1009869598_1009869602 17 Left 1009869598 6:69436988-69437010 CCCTTGATTTGAATGTTACCTTA No data
Right 1009869602 6:69437028-69437050 TTTGTTGTTGTTTTCACTGGTGG No data
1009869598_1009869603 20 Left 1009869598 6:69436988-69437010 CCCTTGATTTGAATGTTACCTTA No data
Right 1009869603 6:69437031-69437053 GTTGTTGTTTTCACTGGTGGTGG No data
1009869598_1009869604 26 Left 1009869598 6:69436988-69437010 CCCTTGATTTGAATGTTACCTTA No data
Right 1009869604 6:69437037-69437059 GTTTTCACTGGTGGTGGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009869598 Original CRISPR TAAGGTAACATTCAAATCAA GGG (reversed) Intergenic
No off target data available for this crispr