ID: 1009869599

View in Genome Browser
Species Human (GRCh38)
Location 6:69436989-69437011
Sequence CTAAGGTAACATTCAAATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009869599_1009869603 19 Left 1009869599 6:69436989-69437011 CCTTGATTTGAATGTTACCTTAG No data
Right 1009869603 6:69437031-69437053 GTTGTTGTTTTCACTGGTGGTGG No data
1009869599_1009869604 25 Left 1009869599 6:69436989-69437011 CCTTGATTTGAATGTTACCTTAG No data
Right 1009869604 6:69437037-69437059 GTTTTCACTGGTGGTGGTATTGG No data
1009869599_1009869601 13 Left 1009869599 6:69436989-69437011 CCTTGATTTGAATGTTACCTTAG No data
Right 1009869601 6:69437025-69437047 TGTTTTGTTGTTGTTTTCACTGG No data
1009869599_1009869602 16 Left 1009869599 6:69436989-69437011 CCTTGATTTGAATGTTACCTTAG No data
Right 1009869602 6:69437028-69437050 TTTGTTGTTGTTTTCACTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009869599 Original CRISPR CTAAGGTAACATTCAAATCA AGG (reversed) Intergenic
No off target data available for this crispr