ID: 1009869602

View in Genome Browser
Species Human (GRCh38)
Location 6:69437028-69437050
Sequence TTTGTTGTTGTTTTCACTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009869599_1009869602 16 Left 1009869599 6:69436989-69437011 CCTTGATTTGAATGTTACCTTAG No data
Right 1009869602 6:69437028-69437050 TTTGTTGTTGTTTTCACTGGTGG No data
1009869598_1009869602 17 Left 1009869598 6:69436988-69437010 CCCTTGATTTGAATGTTACCTTA No data
Right 1009869602 6:69437028-69437050 TTTGTTGTTGTTTTCACTGGTGG No data
1009869600_1009869602 -1 Left 1009869600 6:69437006-69437028 CCTTAGTTAAAATTCTTAATGTT No data
Right 1009869602 6:69437028-69437050 TTTGTTGTTGTTTTCACTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009869602 Original CRISPR TTTGTTGTTGTTTTCACTGG TGG Intergenic
No off target data available for this crispr