ID: 1009869604 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:69437037-69437059 |
Sequence | GTTTTCACTGGTGGTGGTAT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1009869598_1009869604 | 26 | Left | 1009869598 | 6:69436988-69437010 | CCCTTGATTTGAATGTTACCTTA | No data | ||
Right | 1009869604 | 6:69437037-69437059 | GTTTTCACTGGTGGTGGTATTGG | No data | ||||
1009869599_1009869604 | 25 | Left | 1009869599 | 6:69436989-69437011 | CCTTGATTTGAATGTTACCTTAG | No data | ||
Right | 1009869604 | 6:69437037-69437059 | GTTTTCACTGGTGGTGGTATTGG | No data | ||||
1009869600_1009869604 | 8 | Left | 1009869600 | 6:69437006-69437028 | CCTTAGTTAAAATTCTTAATGTT | No data | ||
Right | 1009869604 | 6:69437037-69437059 | GTTTTCACTGGTGGTGGTATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1009869604 | Original CRISPR | GTTTTCACTGGTGGTGGTAT TGG | Intergenic | ||