ID: 1009869604 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:69437037-69437059 |
| Sequence | GTTTTCACTGGTGGTGGTAT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1009869598_1009869604 | 26 | Left | 1009869598 | 6:69436988-69437010 | CCCTTGATTTGAATGTTACCTTA | No data | ||
| Right | 1009869604 | 6:69437037-69437059 | GTTTTCACTGGTGGTGGTATTGG | No data | ||||
| 1009869599_1009869604 | 25 | Left | 1009869599 | 6:69436989-69437011 | CCTTGATTTGAATGTTACCTTAG | No data | ||
| Right | 1009869604 | 6:69437037-69437059 | GTTTTCACTGGTGGTGGTATTGG | No data | ||||
| 1009869600_1009869604 | 8 | Left | 1009869600 | 6:69437006-69437028 | CCTTAGTTAAAATTCTTAATGTT | No data | ||
| Right | 1009869604 | 6:69437037-69437059 | GTTTTCACTGGTGGTGGTATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1009869604 | Original CRISPR | GTTTTCACTGGTGGTGGTAT TGG | Intergenic | ||