ID: 1009869605

View in Genome Browser
Species Human (GRCh38)
Location 6:69437050-69437072
Sequence GTGGTATTGGCTGTTTTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009869600_1009869605 21 Left 1009869600 6:69437006-69437028 CCTTAGTTAAAATTCTTAATGTT No data
Right 1009869605 6:69437050-69437072 GTGGTATTGGCTGTTTTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009869605 Original CRISPR GTGGTATTGGCTGTTTTAAC TGG Intergenic
No off target data available for this crispr