ID: 1009871845

View in Genome Browser
Species Human (GRCh38)
Location 6:69462383-69462405
Sequence ATGTCTTTATTTAGACTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009871844_1009871845 -3 Left 1009871844 6:69462363-69462385 CCACTGTTAGAGATATGTTCATG No data
Right 1009871845 6:69462383-69462405 ATGTCTTTATTTAGACTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009871845 Original CRISPR ATGTCTTTATTTAGACTAGA TGG Intergenic