ID: 1009873593

View in Genome Browser
Species Human (GRCh38)
Location 6:69477956-69477978
Sequence CAATCACATCAACAGCCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009873591_1009873593 27 Left 1009873591 6:69477906-69477928 CCAAGTAAGATTTATCTTAGATA No data
Right 1009873593 6:69477956-69477978 CAATCACATCAACAGCCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009873593 Original CRISPR CAATCACATCAACAGCCTAA AGG Intergenic
No off target data available for this crispr