ID: 1009875083

View in Genome Browser
Species Human (GRCh38)
Location 6:69495663-69495685
Sequence GCGCCGTTTTTTAAGCTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009875083_1009875086 3 Left 1009875083 6:69495663-69495685 CCAACCAGCTTAAAAAACGGCGC No data
Right 1009875086 6:69495689-69495711 ACGAGATGATATCCCACACCTGG No data
1009875083_1009875092 26 Left 1009875083 6:69495663-69495685 CCAACCAGCTTAAAAAACGGCGC No data
Right 1009875092 6:69495712-69495734 CTCAGAGGGTCCTACACCCACGG 0: 131
1: 815
2: 1606
3: 1393
4: 1268
1009875083_1009875088 12 Left 1009875083 6:69495663-69495685 CCAACCAGCTTAAAAAACGGCGC No data
Right 1009875088 6:69495698-69495720 TATCCCACACCTGGCTCAGAGGG 0: 426
1: 889
2: 1389
3: 1499
4: 1243
1009875083_1009875087 11 Left 1009875083 6:69495663-69495685 CCAACCAGCTTAAAAAACGGCGC No data
Right 1009875087 6:69495697-69495719 ATATCCCACACCTGGCTCAGAGG 0: 430
1: 875
2: 1411
3: 1503
4: 1255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009875083 Original CRISPR GCGCCGTTTTTTAAGCTGGT TGG (reversed) Intergenic
No off target data available for this crispr