ID: 1009885202

View in Genome Browser
Species Human (GRCh38)
Location 6:69617025-69617047
Sequence GGGTGATCAGCAGTGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009885202_1009885213 23 Left 1009885202 6:69617025-69617047 CCGTCCACCACTGCTGATCACCC No data
Right 1009885213 6:69617071-69617093 CAACCCCTCTGGATCTGGCAGGG No data
1009885202_1009885209 12 Left 1009885202 6:69617025-69617047 CCGTCCACCACTGCTGATCACCC No data
Right 1009885209 6:69617060-69617082 GCCGCTGACTTCAACCCCTCTGG No data
1009885202_1009885211 18 Left 1009885202 6:69617025-69617047 CCGTCCACCACTGCTGATCACCC No data
Right 1009885211 6:69617066-69617088 GACTTCAACCCCTCTGGATCTGG No data
1009885202_1009885212 22 Left 1009885202 6:69617025-69617047 CCGTCCACCACTGCTGATCACCC No data
Right 1009885212 6:69617070-69617092 TCAACCCCTCTGGATCTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009885202 Original CRISPR GGGTGATCAGCAGTGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr