ID: 1009892429

View in Genome Browser
Species Human (GRCh38)
Location 6:69703506-69703528
Sequence GTCAGTCATCTCTACAGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009892429 Original CRISPR GTCAGTCATCTCTACAGATT TGG (reversed) Intronic
900716123 1:4145509-4145531 GTCAGTCATCTCTGCACTCTGGG - Intergenic
902515597 1:16987851-16987873 TTCAGTCTTCCCTGCAGATTGGG + Intronic
909119020 1:71576744-71576766 GTAAGTGATGTCTACAGATTTGG + Intronic
909894345 1:81047686-81047708 ATGAGTCATCTGTAAAGATTAGG - Intergenic
910145918 1:84078879-84078901 ATCCTTCATCTCTTCAGATTAGG + Intronic
910232646 1:85002319-85002341 GCCAGTAATCTCAACAGTTTGGG + Intronic
911046316 1:93631651-93631673 CTCAGTCATCCCTACAGTTCGGG + Intronic
912546848 1:110457222-110457244 GGCAGTCCTCTGTCCAGATTGGG + Exonic
915729690 1:158044308-158044330 GACAGTCATCTGTACTGACTGGG + Intronic
921189603 1:212698455-212698477 GTCAGTGAACTCTGCAGACTTGG + Intronic
921827001 1:219683543-219683565 GTCAGTGATTTTTACATATTTGG + Intergenic
922798304 1:228352385-228352407 GTCAGTAATCTCAACAATTTGGG + Intronic
923882971 1:238123981-238124003 GTCAGTCATCTTGGCAGAATGGG - Intergenic
1064387856 10:14913609-14913631 GTCAGTCAAATCTACAGATGTGG - Intronic
1064502041 10:15984265-15984287 GTCAGGCATTTCTACACACTTGG + Intergenic
1067421956 10:46159598-46159620 GTCAGGCATCTCTACACTCTTGG - Intergenic
1067499144 10:46786428-46786450 GTCTGTCATCTTTACAGAGGAGG + Intergenic
1067507263 10:46865687-46865709 GTCAGGCATCTCTACACTCTTGG - Intergenic
1067595497 10:47553924-47553946 GTCTGTCATCTTTACAGAGGAGG - Intergenic
1068317257 10:55362799-55362821 TTCAGTGATTTCTATAGATTAGG - Intronic
1068348362 10:55813357-55813379 GTCAGACATCTCTACACTCTTGG + Intergenic
1068757967 10:60675855-60675877 GTCACACTTCTCTACACATTTGG + Intronic
1070703022 10:78617188-78617210 GTCAGTGATCACTACAGGGTGGG + Intergenic
1070859439 10:79638734-79638756 GTCAGGCATCTCTACACTCTTGG - Intergenic
1072839933 10:98761593-98761615 GGCAGTCATGTCTTCATATTTGG - Intronic
1078083458 11:8219976-8219998 ATCAGTCCCCTCTACAGATGAGG + Intergenic
1080168582 11:29270608-29270630 GTCTGTAATCTCAACAGTTTGGG - Intergenic
1081396684 11:42594323-42594345 GTCAGTCAACTTGACAGATAAGG - Intergenic
1093406701 12:18813273-18813295 GTGTCTCATCCCTACAGATTTGG + Intergenic
1095051938 12:37562301-37562323 GTCTGTAATCTCAACAGTTTGGG + Intergenic
1096124532 12:49109941-49109963 GTTCCTCATCTCTACATATTAGG + Intronic
1097548910 12:61041702-61041724 GTCAATCCTATCTATAGATTTGG + Intergenic
1098236423 12:68422570-68422592 GAAAGTCATGTCTAGAGATTTGG - Intergenic
1105869986 13:24496079-24496101 TTCTATCATCTCTACAGACTCGG + Intronic
1107409913 13:40149035-40149057 GTCAGTCATCTTTACTAAATAGG + Intergenic
1107713371 13:43172625-43172647 GTCATTCATCTCTTCTCATTTGG + Intergenic
1108788630 13:53938921-53938943 GTCATTCATCTGAACAGAGTAGG - Intergenic
1110950611 13:81485319-81485341 GACATTCAACTCTACATATTAGG - Intergenic
1113734021 13:112664264-112664286 GTCAGTCTTCTCAACAGAGGTGG - Intronic
1117225248 14:53651737-53651759 TTCAGTCATCTCGGCAGGTTGGG + Intergenic
1117349040 14:54862712-54862734 GTCAGTAATCTCAACACTTTGGG - Intronic
1120140289 14:80923027-80923049 CTTAGTCTTCTCTAGAGATTTGG - Intronic
1123992362 15:25693280-25693302 ACCAGTCATCTCAACAGTTTGGG - Intronic
1131843538 15:96464532-96464554 TTCAGTCATCTCTCTATATTGGG - Intergenic
1137038255 16:35585952-35585974 TTCAGCAAACTCTACAGATTTGG - Intergenic
1137646087 16:50075785-50075807 GTCATTCATTTCAACACATTAGG + Intronic
1139908647 16:70383061-70383083 GTCAGGCATCTCGGCAGATGGGG + Intronic
1140626672 16:76803059-76803081 CTCAGTCACTTCTACAGAATGGG + Intergenic
1144625084 17:16840337-16840359 GTGAGTCATCTCTGAGGATTCGG + Intergenic
1144881346 17:18432384-18432406 GTGAGTCATCTCTGAGGATTCGG - Intergenic
1145150886 17:20512002-20512024 GTGAGTCATCTCTGAGGATTCGG + Intergenic
1146950765 17:36904329-36904351 GTCTGTAATCTCTGCAGTTTGGG + Intergenic
1148816187 17:50329799-50329821 GTCCATCAGCTCTACAGGTTGGG + Intergenic
1152136482 17:78506883-78506905 GGCAGACATCCCTACAGAGTAGG - Intronic
1154201664 18:12304831-12304853 GTCATTCATTTTTCCAGATTTGG + Intergenic
1158181455 18:54719793-54719815 TTGAGTCATCTTTACAGACTTGG - Intronic
1163933466 19:20421120-20421142 CTCAGCAAACTCTACAGATTTGG - Intergenic
1163948370 19:20561627-20561649 TTCAGCAAACTCTACAGATTTGG - Intronic
1163959120 19:20670848-20670870 TTCAGAAAACTCTACAGATTTGG + Intronic
1163969734 19:20780657-20780679 TTCAGCTAACTCTACAGATTTGG + Intronic
1164006626 19:21155791-21155813 TTCAGCAAACTCTACAGATTTGG + Intronic
1164017729 19:21267504-21267526 TTCAGCAAACTCTACAGATTTGG - Intronic
1164101507 19:22058585-22058607 TTCAGCAAACTCTACAGATTTGG + Intronic
1164136139 19:22418042-22418064 TTCAGCAAACTCTACAGATTTGG - Intronic
1164272066 19:23681554-23681576 TTCAGTAAACTCTACAGATTTGG - Intronic
1165718449 19:38062291-38062313 CACTGTCATCTCTAAAGATTGGG - Intronic
1167826544 19:51978675-51978697 GTCAGTCATATCTATAGGATGGG + Intronic
926393402 2:12417374-12417396 GTCAGTCATGTCGGCAGATCAGG - Intergenic
940427598 2:153548383-153548405 GTCAGTTATCTCAACTGATGAGG + Intergenic
942663200 2:178288240-178288262 GTCCCTCAGCTCTTCAGATTAGG - Intronic
942779724 2:179627555-179627577 ATCTGTCATCTCTCCAGATGTGG + Intronic
1177210194 21:18061080-18061102 GTCAGTCATTTCTTCATTTTGGG + Intronic
1179222717 21:39423893-39423915 GTCTGTAATCTCTACACTTTGGG + Intronic
1181020372 22:20098248-20098270 GTCTGTCATCTCAACAATTTGGG - Intronic
1183855174 22:40627728-40627750 GCCTGTCATCTCAACAGTTTAGG + Intronic
956785677 3:72640336-72640358 GGCAGAAATCTCAACAGATTTGG - Intergenic
959563953 3:107815392-107815414 GCCAGTCCTCTGTACACATTAGG - Intergenic
965068314 3:163881825-163881847 GGCAATCATCTGTACAAATTGGG - Intergenic
970702666 4:18761274-18761296 GTTTGACATCTCTAAAGATTTGG - Intergenic
973893867 4:55393641-55393663 TTCAGTCATCTCAACATATGAGG - Intergenic
977137020 4:93317737-93317759 GTGAGTCATCTCTTCATATAGGG + Intronic
978865228 4:113499591-113499613 GTCAGTAATCTTTTCAGATGAGG + Intronic
979538100 4:121847501-121847523 GTAATTCATCTCTACAGGCTGGG - Exonic
987122050 5:14776936-14776958 ATCAGTCTTCTCTACACAATGGG + Intronic
989272803 5:39552543-39552565 GTCAGTCATCATGACATATTTGG + Intergenic
989608919 5:43273016-43273038 GTCAGACTTCTCATCAGATTTGG + Intronic
989997369 5:50851952-50851974 GTCATCCATTTATACAGATTAGG + Intergenic
995051320 5:107708030-107708052 CTCAGTCATTTTTACAAATTAGG - Intergenic
996024283 5:118626887-118626909 GTTAGGCAACTCTACACATTCGG - Intergenic
1009830590 6:68927039-68927061 GGCAGTCATCTCTAATCATTTGG + Intronic
1009892429 6:69703506-69703528 GTCAGTCATCTCTACAGATTTGG - Intronic
1012641718 6:101625769-101625791 CTCAGTCATCTTTATATATTTGG - Intronic
1017663849 6:156699644-156699666 TTCAGCCATTTCTACAGAGTTGG - Intergenic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1021636823 7:22702127-22702149 GCCTGTCATCTCAACAGTTTGGG + Intergenic
1022924264 7:35044248-35044270 GTTAGCCATGTCAACAGATTTGG - Intergenic
1023181030 7:37484021-37484043 ATCAGACATTTCTACAGTTTAGG + Intergenic
1023607588 7:41944029-41944051 TTCAGTCATCTGGACAGATGAGG + Intergenic
1026550481 7:71364254-71364276 GTCAGGCCTCAGTACAGATTTGG + Intronic
1026893663 7:73997836-73997858 GTCTGTAATCCCAACAGATTGGG - Intergenic
1028676212 7:93464870-93464892 CTACGTCATCTCTACATATTGGG - Intronic
1032756938 7:134899904-134899926 GTCTGTAATCTCTACACTTTGGG - Intronic
1033155417 7:138952542-138952564 GTCACTCATCTCTACACAGTAGG + Intronic
1041967586 8:63697915-63697937 CTCAGTCATAACTACATATTAGG + Intergenic
1043277450 8:78417368-78417390 CTCAGTGATCTCTAAGGATTCGG - Intergenic
1044748572 8:95394813-95394835 GTCAGTCTTCTCCACACCTTAGG - Intergenic
1050124225 9:2339718-2339740 TTCAGTCATGTCTAGAAATTTGG - Intergenic
1056324898 9:85469082-85469104 GTCCATCATCTCTACAGAATTGG + Intergenic
1185836755 X:3351878-3351900 TTGAGTTATCTCTGCAGATTAGG + Intergenic
1186509274 X:10118217-10118239 ATCGGTCATTTCTACTGATTTGG + Intronic
1186704988 X:12131512-12131534 GTCACTTATATTTACAGATTTGG + Intergenic
1187586280 X:20665603-20665625 ATCAGTCATTTCTCCAGAGTGGG + Intergenic
1189532395 X:41900285-41900307 TTCATTCATGTCTCCAGATTTGG + Intronic
1190569038 X:51763298-51763320 GTGAGTCGGCTCTACAGAATGGG - Intergenic
1191867022 X:65712127-65712149 GTCAGTGACCCCTACAGAATGGG - Intronic
1196082487 X:111648664-111648686 TTCATTTTTCTCTACAGATTCGG + Intergenic
1196699320 X:118650605-118650627 GTCAGCCATCATTACACATTAGG + Intronic
1201239869 Y:11948181-11948203 TTGAGTTATCTCTGCAGATTAGG - Intergenic
1202260195 Y:22962322-22962344 GTCAGTTATCTCTACTGGATGGG - Intergenic
1202413182 Y:24596063-24596085 GTCAGTTATCTCTACTGGATGGG - Intergenic
1202457600 Y:25074005-25074027 GTCAGTTATCTCTACTGGATGGG + Intergenic