ID: 1009895737

View in Genome Browser
Species Human (GRCh38)
Location 6:69746636-69746658
Sequence GCATTGGAGGGTCCCTTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 1, 2: 2, 3: 9, 4: 94}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009895730_1009895737 29 Left 1009895730 6:69746584-69746606 CCATCTGGAGAAACTTGCCAAAT 0: 1
1: 7
2: 19
3: 49
4: 480
Right 1009895737 6:69746636-69746658 GCATTGGAGGGTCCCTTCAAAGG 0: 1
1: 1
2: 2
3: 9
4: 94
1009895731_1009895737 12 Left 1009895731 6:69746601-69746623 CCAAATATGATGACATAAAGAAG 0: 1
1: 11
2: 18
3: 55
4: 414
Right 1009895737 6:69746636-69746658 GCATTGGAGGGTCCCTTCAAAGG 0: 1
1: 1
2: 2
3: 9
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009895737 Original CRISPR GCATTGGAGGGTCCCTTCAA AGG Intronic
901431950 1:9221647-9221669 GCATTAGAGGATCGCTTCACAGG - Intergenic
902387817 1:16085793-16085815 GCCTGGGAGGCTCCCTTGAAGGG - Intergenic
904553291 1:31339596-31339618 GCATTGGAGTGCTCCATCAATGG + Intronic
905349399 1:37334325-37334347 GCATTGGACAGTCCCATCCATGG + Intergenic
905472556 1:38204485-38204507 GCATGGGAGGCTGGCTTCAATGG + Intergenic
911655257 1:100436145-100436167 GAATTGGAAGATCCCTTCTAAGG - Intronic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
913456960 1:119042574-119042596 GCAGTGCAGGATCCCTTAAAGGG - Intronic
1067183017 10:44004894-44004916 TCAGGGGAGGGTCCCTTCATTGG + Intergenic
1067804628 10:49384379-49384401 GCACTGTAGGGGCCCTTCAGGGG - Intronic
1068338347 10:55667540-55667562 GCATCGGAGGGCCCGCTCAAGGG - Intergenic
1068488236 10:57687321-57687343 GCATTGAAGGGTCCTTGGAATGG + Intergenic
1069558106 10:69411039-69411061 GCATTTGGGGGTCCCTTTCATGG + Intronic
1069676677 10:70253771-70253793 GCCTTGGAGGGTCCTTTCACAGG - Exonic
1070872679 10:79771301-79771323 GCACTGGAGGTTCAGTTCAAGGG - Intergenic
1071639602 10:87293450-87293472 GCACTGGAGGATCAGTTCAAGGG - Intergenic
1071655633 10:87444502-87444524 GCACTGGAGGATCAGTTCAAGGG + Intergenic
1072170682 10:92858525-92858547 TCATTGGAGGGTCCCAACAGTGG - Intronic
1074501053 10:114025203-114025225 GCACTGGAGTGTCCCTGCCATGG - Intergenic
1076177658 10:128380801-128380823 GCCCTGGGGAGTCCCTTCAAGGG + Intergenic
1077024771 11:434157-434179 TCATTGGCGGGTCCCTGCAGCGG + Intronic
1078877464 11:15412756-15412778 GCATTTAAGGGTCCCTTGGAGGG + Intergenic
1078984893 11:16584218-16584240 GCATTGGACGATCACTTAAATGG + Intronic
1086581794 11:88408371-88408393 GCATCAGAAGGCCCCTTCAAGGG - Intergenic
1089794621 11:120970307-120970329 GCAGTGCAGGGACCCTCCAAAGG + Intronic
1090453066 11:126823581-126823603 TCATTGGTGGGTCCCTGCAGTGG + Intronic
1092193928 12:6537851-6537873 GCGTCGGAGGGCCCCCTCAAGGG + Exonic
1095274239 12:40260756-40260778 CCATTGCTGGGTCCCTTCACTGG - Intronic
1097991032 12:65834254-65834276 CCTTTGGAGTGGCCCTTCAAAGG - Intronic
1098013670 12:66081541-66081563 GCATTAGAGGATTTCTTCAAAGG - Intergenic
1103955488 12:124574168-124574190 GCACAGGAGGGCCCCATCAAGGG + Intergenic
1105547122 13:21359103-21359125 GTATCGGAGGGCCCCCTCAAGGG + Intergenic
1111041315 13:82752327-82752349 GCATTGAAGAGTCCCTTTAATGG - Intergenic
1114413091 14:22518729-22518751 CCTTTGGAGGGTCCCTTCTCAGG + Intergenic
1126780854 15:52137800-52137822 GCAATGGAGGGGACCTGCAAGGG + Intronic
1129969470 15:79764971-79764993 GCAATGGAGAGTACCATCAAAGG + Intergenic
1130451242 15:84054532-84054554 GCTTTGGAGAGACTCTTCAAAGG + Intergenic
1133455668 16:5940433-5940455 GAATTGGAGGGACCTTTCCAAGG + Intergenic
1136287440 16:29252831-29252853 GGATTGGGGAGACCCTTCAAAGG + Intergenic
1136504414 16:30693773-30693795 GCAATGGAAGGTCCATTAAAGGG + Intergenic
1139259459 16:65577818-65577840 GCAGTGGAGGGTCCCTAAGATGG + Intergenic
1140995756 16:80258242-80258264 ACACTGGAGGGTCACTTCCAAGG + Intergenic
1142093055 16:88225460-88225482 GGATTGGGGAGACCCTTCAAAGG + Intergenic
1143206840 17:5148218-5148240 GTATTGGACGGTGTCTTCAAAGG + Intronic
1144548102 17:16215870-16215892 GGTTTGCAGGGTCCCTTCCACGG - Intronic
1149855764 17:60081234-60081256 CCAATGCAGGGTGCCTTCAAAGG - Intergenic
1151774422 17:76189743-76189765 GCTTCGGAGGGTCCCTTCTCCGG - Intronic
1153784798 18:8525079-8525101 GTTTTGCAGGGACCCTTCAAAGG - Intergenic
1157156731 18:45274929-45274951 GCATTTGAAGGTCTCTTCCAGGG + Intronic
1163763386 19:19149069-19149091 TGAGTGGAGGGTCCCTTCTAGGG + Intronic
1166969919 19:46559427-46559449 GCATTGGAGGACCCCCTCAAGGG + Intronic
925183068 2:1829528-1829550 GCATGGGAGGGTCAGTTCACAGG - Intronic
925183073 2:1829552-1829574 GCATGGGAGGGTCAGTTCACAGG - Intronic
925183078 2:1829576-1829598 GCATGGGAGGGTCAATTCACAGG - Intronic
925418164 2:3688176-3688198 GCATTGGAGGGCCCCCTCAAGGG - Intronic
926891011 2:17638853-17638875 GCATAGGAGGGCCCCTTCCCAGG + Intronic
930236899 2:48897317-48897339 GCATTGGTAAGTACCTTCAAAGG - Intergenic
930578984 2:53186760-53186782 GCACTGGAAGGTCTGTTCAATGG + Intergenic
931851102 2:66251505-66251527 GCCTTGCAGGGTGCTTTCAATGG + Intergenic
937192839 2:120121146-120121168 CCATAGTAGAGTCCCTTCAATGG - Intronic
937482623 2:122278030-122278052 GCATTGGAGTTTCCCCTCCACGG - Intergenic
947539534 2:230966234-230966256 ACATTGTAGGGTTCCTACAATGG + Intergenic
948772714 2:240259721-240259743 ACATGGGAGGGTGCCTCCAAGGG - Intergenic
1172324667 20:34025122-34025144 GCGTTGGAGGCTGCCTTCAGGGG + Intronic
1175438025 20:58968265-58968287 GCAAAGGAGGGTCCCTGTAATGG + Intergenic
1178096708 21:29223070-29223092 GCATTGGAGGGCCCCTTCAAGGG + Intronic
1181096914 22:20511675-20511697 GAACTGGAGAGTCCCTGCAATGG - Intronic
1181668221 22:24412845-24412867 CCAAGGGAGGGTCCCGTCAAGGG + Intronic
1184100673 22:42340420-42340442 GCAGTGGAGGTCCCTTTCAATGG - Intronic
1184417847 22:44362532-44362554 GCCCTGGTGGGTCCATTCAATGG + Intergenic
1184530539 22:45052435-45052457 GCATTGCTGGGTCCCTTCTCAGG + Intergenic
950101242 3:10358284-10358306 GGATTCCAGGGTCCCTACAAAGG - Intronic
950370935 3:12529894-12529916 CCATTGGAGTGTCACTTAAATGG + Intronic
953930482 3:47003429-47003451 GCTTTGGACAGTCCCTTCAGGGG - Intronic
963292196 3:143503461-143503483 GCTTTGGAGGGTCCCCTCAAGGG - Intronic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
971513733 4:27461048-27461070 ACATTAGAGGATCCCTCCAAGGG - Intergenic
976223670 4:82778486-82778508 CCTTTGGAAGGTCCCTACAAGGG + Intronic
976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG + Intronic
985962248 5:3311466-3311488 GCAATGGAGGGTCCTTTAACAGG + Intergenic
986645226 5:9910588-9910610 GCAGTGGGGGATCCCTGCAAGGG - Intergenic
988840765 5:35081486-35081508 GCATCGGAGGGCCCCTTCATAGG + Intronic
991594155 5:68285452-68285474 ACATTAGAGGGTTGCTTCAAAGG + Intronic
993204857 5:84865587-84865609 GAATTGGAGGGTGTGTTCAAAGG - Intergenic
995154710 5:108896993-108897015 CCCTTGGAGGCTGCCTTCAATGG - Intronic
1000300312 5:159950686-159950708 GCATTGGAGTGTCCCCCCAAGGG - Intronic
1000722138 5:164721284-164721306 TCATTGCAGGGTCACTACAAAGG + Intergenic
1003404557 6:5817610-5817632 GTATTGGAGGGCCCCCTCAAGGG - Intergenic
1009895737 6:69746636-69746658 GCATTGGAGGGTCCCTTCAAAGG + Intronic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1017269261 6:152487655-152487677 GTATTGGAGGGTCCATTAAAGGG - Intronic
1024772310 7:52737417-52737439 GCAATGGAGAGACCCTTCTAGGG - Intergenic
1029359622 7:100079121-100079143 TCCTAGCAGGGTCCCTTCAATGG + Exonic
1034621172 7:152458281-152458303 GAAATGGAGAGTGCCTTCAAAGG - Intergenic
1035388815 7:158491401-158491423 GGATTGGAGGCTCCCGTCAATGG - Intronic
1035457934 7:159021370-159021392 GGCTTGGAGGGGCCCTTTAAAGG - Intergenic
1036507454 8:9368482-9368504 GCATTAGAAGGGCCCTTCCAAGG + Intergenic
1040620183 8:49083391-49083413 GAATTAGAAGGTCCCTTCACTGG + Intergenic
1040779721 8:51093561-51093583 GCATTGAAGAATGCCTTCAATGG + Intergenic
1041739855 8:61146485-61146507 GCATTGCAGGATGCCTTCCATGG - Intronic
1052995956 9:34551791-34551813 GCATTGGAGGGTCCAGCCCAAGG + Exonic
1055117528 9:72622099-72622121 GCACTGGAGAGACCCTGCAATGG + Intronic
1061424218 9:130489077-130489099 GCGTCTGAGGGCCCCTTCAAAGG + Intronic
1185761082 X:2690626-2690648 GCAGGGGAGGGTCCCTGCTAGGG + Intergenic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1191141310 X:57119202-57119224 ACATTGGAGGTTCCCTAGAAGGG - Intronic
1192448790 X:71229908-71229930 GAATTGGAGAGTCTCTCCAAGGG - Intergenic