ID: 1009897702

View in Genome Browser
Species Human (GRCh38)
Location 6:69773811-69773833
Sequence ATGCTAGTGTTGATGAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 315}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009897702_1009897704 -10 Left 1009897702 6:69773811-69773833 CCATTTTTCATCAACACTAGCAT 0: 1
1: 0
2: 1
3: 39
4: 315
Right 1009897704 6:69773824-69773846 ACACTAGCATGGATAAACTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009897702 Original CRISPR ATGCTAGTGTTGATGAAAAA TGG (reversed) Intronic
900842202 1:5061717-5061739 ATGCTAGTGGGAATGTAAAATGG + Intergenic
903955919 1:27025560-27025582 CTGCTAGTGAGAATGAAAAATGG - Intergenic
904069914 1:27786918-27786940 ATGTTAGTGATGAAGAAAAGTGG + Intronic
907552338 1:55314912-55314934 ATGCTGGTTTTGATGACATAAGG - Intergenic
907589073 1:55648450-55648472 AGGCTATTGATGATGAAAAATGG + Intergenic
907662421 1:56405494-56405516 ATTCTAGTTTTTATGAAGAAAGG - Intergenic
907774057 1:57495662-57495684 ATGCCAGTGTTTATGAAATATGG + Intronic
908289209 1:62645092-62645114 TTGCTAGTGGTAATGTAAAATGG + Intronic
908349211 1:63267726-63267748 ATGCTAATAATGATGGAAAAAGG + Intergenic
908779851 1:67680375-67680397 GTGGTAGTGGTGATGAGAAATGG + Intergenic
910898957 1:92098515-92098537 ATGCTGGTGGTAATGTAAAATGG - Intronic
911128342 1:94362876-94362898 TTGCTGGTGGTGATGTAAAATGG - Intergenic
911550317 1:99270697-99270719 ATGCTAAAGTTTATGTAAAAGGG - Intronic
913237343 1:116796377-116796399 ATGCTAGGTTTGATGAAGCACGG + Intergenic
913361609 1:117987084-117987106 ATGCTAGGTTTGATGAAGAATGG - Intronic
914450767 1:147789472-147789494 ATGTTGATGTTGATGAAGAAGGG + Intergenic
915067202 1:153235078-153235100 ATGCTAGTATTAATGAAAATTGG + Intergenic
916003735 1:160640446-160640468 AAGCTAGTGTTCATAAAAGAAGG + Intronic
916094174 1:161333752-161333774 CTGCTAGTGTGAATGTAAAATGG - Intronic
916772222 1:167921534-167921556 ATGCTGATGTTAAAGAAAAATGG - Intronic
916898805 1:169198245-169198267 CTGCTAGTGGTAATGTAAAATGG + Intronic
917137451 1:171801313-171801335 GTGCTTGTGTTGATAAAAAGAGG + Intronic
920251137 1:204623236-204623258 AACCAAGTGTTGATGAAGAAGGG - Intronic
920927603 1:210357501-210357523 ATGCTAGGTTTGATGAAGATTGG - Intronic
922003084 1:221501149-221501171 GCGCTACTGTTGATGAACAAGGG - Intergenic
922034890 1:221838787-221838809 ATGCTTGGGTTGATGAAGAGTGG + Intergenic
922123849 1:222702493-222702515 CTGTTAGTGATTATGAAAAATGG - Intronic
922150768 1:223002094-223002116 ATGCTAGTTTTGTTTACAAAAGG - Intronic
922871929 1:228909864-228909886 ATTCTACTGTTGATGGAAATTGG - Intergenic
1063283734 10:4660748-4660770 ATGCTAATGTTCAGGAGAAAGGG - Intergenic
1064091045 10:12385145-12385167 CTGCTGGTGTGGATGTAAAATGG + Intronic
1067157996 10:43799061-43799083 GTGCTAGTTTTGGTGAAAGAGGG + Intergenic
1067790676 10:49285056-49285078 CTGCTGGTGGGGATGAAAAATGG + Intergenic
1068302476 10:55162333-55162355 AACATAGTGTTGATGTAAAAAGG + Intronic
1069011341 10:63376815-63376837 ATGCTGGTGGAAATGAAAAATGG + Intronic
1069220180 10:65873239-65873261 TTGCTAGTGGGAATGAAAAATGG - Intergenic
1070430203 10:76330305-76330327 ATGCTTATGTTGATGAAGAATGG + Intronic
1070995274 10:80773441-80773463 CTGCTAGTGGGGATGTAAAATGG - Intergenic
1071200275 10:83214314-83214336 ATTCTGGTGTTCATGAAAACCGG + Intergenic
1071309829 10:84332300-84332322 ATGTTAGTGCTAATGAAAATTGG - Intronic
1073308352 10:102521070-102521092 TTGCTAGTGGGAATGAAAAATGG - Intronic
1074679013 10:115884044-115884066 ATGCTAGAGCTGAGGAAAAATGG + Intronic
1074679546 10:115890300-115890322 ATGTTAGAGCTGGTGAAAAATGG - Intronic
1078766896 11:14306828-14306850 ATCTTAGATTTGATGAAAAAGGG - Intronic
1078806881 11:14714743-14714765 TGGCTAGTGTGGCTGAAAAATGG + Intronic
1079967856 11:27000958-27000980 ATTCTAGGATTGATGATAAATGG + Intergenic
1081047024 11:38288046-38288068 ATACTAGTGGGGATGTAAAATGG + Intergenic
1081452898 11:43189880-43189902 ATACTAATGATTATGAAAAAAGG + Intergenic
1082779178 11:57273081-57273103 ATGCTAATGTTGAAAAAACATGG - Intergenic
1086775558 11:90828198-90828220 TTGCTAGTGTGAATGAAACAAGG + Intergenic
1086840037 11:91673603-91673625 ATACTAGATTTGATGAAAAGTGG - Intergenic
1086999948 11:93407755-93407777 CTTCTAGTGTTGATTAATAATGG - Intronic
1087728275 11:101748846-101748868 TTCCTAGTGTTCATTAAAAAAGG - Intronic
1088158791 11:106842699-106842721 ATCATAGTGGTGAGGAAAAAGGG + Intronic
1088670655 11:112137049-112137071 ATCTTAGATTTGATGAAAAAGGG + Intronic
1088946378 11:114517505-114517527 ATGGTAGTGTACATAAAAAAGGG - Intergenic
1089030515 11:115323033-115323055 TTGCTAGTGGTAATGTAAAATGG - Intronic
1092661279 12:10740698-10740720 ATGCTAGTGTTGCTGAAGAGAGG - Intergenic
1092950282 12:13496766-13496788 ATGCTAGATTTGATGCAATATGG - Intergenic
1093006857 12:14060667-14060689 GTGCTAGTGTAGATGGAGAAAGG + Intergenic
1093041632 12:14387855-14387877 ATGAAATTGTTCATGAAAAAGGG - Intronic
1093304092 12:17490761-17490783 ATGATAGTGGTGATGAAGCAGGG + Intergenic
1093312355 12:17605357-17605379 ATCTAAGTTTTGATGAAAAAAGG + Intergenic
1093605314 12:21081892-21081914 ATGCTATTGTTTATGTAAAGTGG + Intronic
1093859712 12:24149067-24149089 ATGCTAATATTGATTCAAAATGG + Intergenic
1094216167 12:27944965-27944987 ATGCTAGTGCTGATGCAGAGAGG + Intergenic
1095251533 12:39984737-39984759 ATGTCCGTCTTGATGAAAAATGG + Intronic
1098940962 12:76535455-76535477 ATGTAAGTGTTGATGAGAAGGGG + Intronic
1100197224 12:92260551-92260573 ATGCCAGTGTTGGAGAAAATGGG - Intergenic
1101889824 12:108703216-108703238 AAGCTAATGTAGAAGAAAAAAGG + Intronic
1102263866 12:111464466-111464488 AGGCTGGAGTTAATGAAAAATGG - Intronic
1103021262 12:117536259-117536281 GAGCTTCTGTTGATGAAAAATGG - Intronic
1104187052 12:126442944-126442966 ATGTTTGTGTTGCTGGAAAAAGG + Intergenic
1108328692 13:49361747-49361769 ATGACAGAGTTCATGAAAAAAGG - Intronic
1108569972 13:51740053-51740075 AAGCTAGTGTTGCTTAAAACCGG - Intronic
1110795568 13:79633221-79633243 TTGCTAGTGGGAATGAAAAATGG + Intergenic
1110937694 13:81312543-81312565 TTGCTAGTGGGAATGAAAAATGG - Intergenic
1111105306 13:83637873-83637895 ATGCTAATGTTGTTGAACAAAGG - Intergenic
1111197032 13:84888393-84888415 ATTCTAGTGTTGATGCATACAGG - Intergenic
1112737337 13:102435474-102435496 ATGCTAGAGTTTCAGAAAAAGGG - Intergenic
1113245542 13:108390893-108390915 GTGCTAGTGAAGATGAAAAGGGG - Intergenic
1113367206 13:109687541-109687563 ATGCTAGTGTTATTGAAAACTGG + Intergenic
1113534485 13:111053727-111053749 ATGCTGGTGTGGATGTAAAAGGG - Intergenic
1115677278 14:35691648-35691670 ATGCTACTATGGCTGAAAAAAGG + Intronic
1116751060 14:48884315-48884337 CTGCTAGTGGGGATGTAAAATGG - Intergenic
1116839850 14:49809067-49809089 TTGCTGGTGGTGATGTAAAAGGG + Intronic
1117082323 14:52165207-52165229 ATGCCCGTGTTGAGTAAAAAGGG + Intergenic
1118399172 14:65363764-65363786 ATGCTAGGTTTGATGAAGAGTGG - Intergenic
1119162692 14:72466275-72466297 TTGCTAGTGGTAATGCAAAATGG + Intronic
1120040701 14:79749608-79749630 AAGCCAGTGTTGATGGCAAATGG - Intronic
1121877733 14:97469325-97469347 ATTCTTGTGCTGATGAAAAGTGG + Intergenic
1122444064 14:101756305-101756327 ATCCAAGTATTGAAGAAAAATGG - Intergenic
1123800241 15:23811503-23811525 ATGTCAGTGAAGATGAAAAATGG + Intergenic
1124239642 15:28018939-28018961 ATGCTAGGTTTGATGAAGAGTGG - Intronic
1124508348 15:30298761-30298783 CTGCTGGTGTGAATGAAAAATGG - Intergenic
1124622793 15:31285796-31285818 CTGCTAGTGGGGATGTAAAATGG + Intergenic
1124699235 15:31896934-31896956 ATGCTAGCTTGGATGACAAAAGG + Intergenic
1124735209 15:32239895-32239917 CTGCTGGTGTGAATGAAAAATGG + Intergenic
1125895628 15:43299490-43299512 CAGCTAGGGTGGATGAAAAATGG + Intronic
1126175569 15:45732471-45732493 AAGCTAGTCCTGATGAAAAGAGG + Intergenic
1126177284 15:45748049-45748071 ATGCTAGTTGTGATGTAAATAGG - Intergenic
1126352258 15:47756666-47756688 ATACTAGTTATGCTGAAAAAGGG - Intronic
1126502781 15:49365303-49365325 GTTCTGGTGCTGATGAAAAAGGG - Intronic
1126629545 15:50720046-50720068 GTTCTGGTGCTGATGAAAAAGGG - Exonic
1126861255 15:52885145-52885167 ATGCCAGTGTGGAAGCAAAAGGG - Intergenic
1131584846 15:93682274-93682296 ATGCTGGTCTTGATGTGAAAAGG + Intergenic
1133321431 16:4916093-4916115 TTGCTAGTGGGGATGCAAAATGG + Intronic
1137232875 16:46584231-46584253 ATGGAAATGTTGATTAAAAATGG - Intronic
1138425273 16:56927948-56927970 AAGCCAGCTTTGATGAAAAAAGG + Intergenic
1138922722 16:61552236-61552258 ATGGTAGTGTTTAAGAAAACGGG - Intergenic
1140022296 16:71249985-71250007 ATTCTACTGTTGATGAAGATTGG + Intergenic
1143436600 17:6932840-6932862 TTGCTGGTGGGGATGAAAAATGG + Intronic
1144221465 17:13103655-13103677 ATGCTAGGTTTGATGAAGAATGG + Intergenic
1145724748 17:27108307-27108329 AACATAGTGTTGATGTAAAAAGG - Intergenic
1146245111 17:31274284-31274306 ATGCTAGTTATCATGGAAAACGG - Intronic
1147549369 17:41428609-41428631 ATGATGGTGTTGATGAAACCTGG + Intergenic
1148982671 17:51592217-51592239 ATGCTGGTATTGAAGATAAAAGG + Intergenic
1150527925 17:65943303-65943325 ATGTTAGTGTGGGTGAAGAAAGG + Intronic
1151410120 17:73919577-73919599 CTGCTAGTGGGAATGAAAAATGG + Intergenic
1155781466 18:29841981-29842003 TTGCTGGTGTGGATGAAAAATGG - Intergenic
1158562947 18:58530828-58530850 GGGCTAGTGTTGAGGGAAAACGG + Intronic
1159597392 18:70395444-70395466 ATCCTAGTATTGATGAGATATGG + Intergenic
1159958660 18:74538636-74538658 CTGCTAGTGAGGATGCAAAATGG - Intronic
1160143156 18:76343947-76343969 ATGATAGTGATGATGAAAATGGG + Intergenic
1161955498 19:7492272-7492294 ATGCTGGTGGGGATGGAAAATGG - Intronic
1163259031 19:16175689-16175711 TTGCTGGTGTTGATGCAAAATGG + Intergenic
1163365524 19:16873863-16873885 ATGCTAATTTTTAAGAAAAAGGG - Intronic
1164715464 19:30387569-30387591 ATGTCAGTGTGGGTGAAAAACGG - Intronic
931062326 2:58545247-58545269 ATGCTAGGTTTGATGAAGAGTGG + Intergenic
933412321 2:81941630-81941652 CTGTTAGTGTTGCTGAAAAAAGG - Intergenic
933989498 2:87623997-87624019 ATGCTCATGATGATGAGAAAGGG - Intergenic
935095789 2:99942995-99943017 GTGGTAGTGCTGCTGAAAAATGG - Intronic
935126098 2:100224208-100224230 ATGCTGGAGGTGGTGAAAAATGG - Intergenic
935468098 2:103423501-103423523 ATGCTATTTTTGGGGAAAAAAGG + Intergenic
936304344 2:111326829-111326851 ATGCTCATGATGATGAGAAAGGG + Intergenic
936465713 2:112747520-112747542 ATGCAGGTGTTTATGAAAGAGGG + Intronic
937438705 2:121899539-121899561 ATGAAAATGGTGATGAAAAAAGG + Intergenic
940238620 2:151538686-151538708 ATGCTAATGTACATGGAAAAGGG + Intronic
940895510 2:159078936-159078958 ATGATAGTGTTGAAGATATAGGG + Intronic
941093299 2:161204988-161205010 ATGCTTGTGATGTAGAAAAACGG - Intronic
941098109 2:161264386-161264408 ATGACAGTGCTTATGAAAAATGG - Intergenic
942119954 2:172766686-172766708 CTGTTGGTGTTGATGAAGAAAGG - Intronic
943235517 2:185313658-185313680 ATGCTAATTTTGATTAAAAGAGG - Intergenic
945010693 2:205459940-205459962 AGGCCAGTGTTGGTGAAAGATGG + Intronic
945554034 2:211256935-211256957 ATGCTAGGCTGGATGAAAAATGG - Intergenic
946209023 2:218132371-218132393 ATGTTAGTCTAGGTGAAAAAAGG - Intronic
947076051 2:226347235-226347257 CACCAAGTGTTGATGAAAAATGG + Intergenic
1168950666 20:1799012-1799034 TTGCTAGTGGGAATGAAAAATGG + Intergenic
1169047950 20:2551084-2551106 TTGCTAGTGAGGATGCAAAATGG - Intronic
1169454835 20:5743377-5743399 GTGCTAGTGAGGATGGAAAAGGG - Intergenic
1169494948 20:6106403-6106425 ATGCTGGTGTAGATGAGAAAGGG + Intronic
1169583698 20:7056905-7056927 CTGCAAGTGTGGAAGAAAAATGG - Intergenic
1169860733 20:10148904-10148926 ATTCTACTGTTGATGAACATGGG - Intergenic
1170976631 20:21171038-21171060 TTGCTAGTGATAATGCAAAATGG - Intronic
1171361005 20:24586349-24586371 ATGCTTGTGCTGATGGAGAAGGG - Intronic
1172724881 20:37031596-37031618 TTGCTAGTGGTAATGTAAAATGG + Intronic
1175055879 20:56197527-56197549 ATGCTAATGGTGATGAAATGAGG - Intergenic
1175393996 20:58646160-58646182 AGGCTAGTGTGGCTGAAAAGGGG + Intergenic
1176990820 21:15494377-15494399 TGGCTAGAGCTGATGAAAAAGGG + Intergenic
1176995052 21:15544955-15544977 ATCCCAGTGGTGCTGAAAAAAGG + Intergenic
1177221707 21:18202257-18202279 TTGATAATGTGGATGAAAAAAGG + Intronic
1178355224 21:31905772-31905794 ATGCCTGTGTTCATGAGAAAGGG - Intronic
1178717185 21:34976325-34976347 AGGATAGTGATCATGAAAAAAGG - Intronic
1183125084 22:35770136-35770158 GTGCTAGTGTAGATGACAAATGG - Intronic
1183923402 22:41187418-41187440 CTGCTAGTGATCATGGAAAATGG + Intergenic
949213972 3:1542432-1542454 ATGCTAGTGCTTTTAAAAAATGG + Intergenic
949723085 3:7013111-7013133 ATGGTAGGGTTGATGAAGAATGG - Intronic
949792647 3:7809995-7810017 ATGCTAGGCTTGATGAAGAATGG + Intergenic
950600526 3:14031251-14031273 TTGCTAGAGTTTATGTAAAATGG - Intronic
950885382 3:16357944-16357966 ATGCTATTGTGGTTGAACAATGG - Exonic
952017344 3:28973468-28973490 ATGAAAATGTTGATGAAATATGG + Intergenic
952850840 3:37727921-37727943 ATGAAAGTGATGTTGAAAAATGG - Intronic
953256957 3:41300042-41300064 CTGCTGGTGTTGGTGAAAATTGG - Intronic
955018322 3:55093291-55093313 GTGCTAGTGGGAATGAAAAATGG - Intergenic
955372725 3:58367618-58367640 ATGCTTGATTTGATGAAGAATGG + Intronic
955630412 3:60967156-60967178 ATACTACTGCTGATGAAAAATGG - Intronic
955637896 3:61050035-61050057 ATGCTAGGTTTGATGAAGAGTGG - Intronic
955814369 3:62826415-62826437 ATGTTATTGTTGGGGAAAAATGG + Intronic
955889969 3:63639656-63639678 TTGCTAGTGGTGATGTAAAGTGG + Intergenic
956014732 3:64869922-64869944 AAACTAGAGATGATGAAAAAAGG - Intergenic
956216641 3:66856301-66856323 ATGCTAGAGTTGGGGAAGAAGGG + Intergenic
956705686 3:71996897-71996919 ATGCTAGGTTTGATGAAGAATGG - Intergenic
956942688 3:74182043-74182065 ATCCTAGTTTTGAGGAAACATGG - Intergenic
958925671 3:100154605-100154627 ATGCTTGTTTTGTTGTAAAATGG + Intronic
959001874 3:100973580-100973602 ATGAAAGTGTTGGTGAAAGAAGG - Intronic
959818972 3:110709686-110709708 CTGCTAGTGGTGCAGAAAAATGG - Intergenic
959909673 3:111749743-111749765 ATACTATTGTTAAAGAAAAAAGG - Intronic
960743813 3:120864104-120864126 ATGCTAATGTTGTTGAAATATGG - Intergenic
963406020 3:144865112-144865134 TTGTTAATGTTGATGGAAAATGG + Intergenic
963672821 3:148273284-148273306 ATGCTAGTGTAAAAGAAAATAGG + Intergenic
964377352 3:156061631-156061653 TTGCTAGTGGTAATGCAAAATGG - Intronic
964670065 3:159215156-159215178 ATGCTGGGCTTGATGAAAAATGG + Intronic
964787472 3:160413974-160413996 ATACTAGTGTCATTGAAAAATGG - Intronic
964807308 3:160625117-160625139 TTGCTAGTGGTAATGCAAAATGG - Intergenic
964820029 3:160758084-160758106 AAGCTAGAGTGGATGGAAAATGG - Intronic
965412149 3:168345483-168345505 ATGTTATCGTTGTTGAAAAAAGG + Intergenic
966470839 3:180287080-180287102 ATGATAGGGATGATGATAAACGG - Intergenic
966693624 3:182766732-182766754 ATTTTACTGTTGAAGAAAAAGGG + Intergenic
967288870 3:187900049-187900071 ATGCTAATGATGATGATAACAGG + Intergenic
972346069 4:38193348-38193370 CTGATAGTGTTCATGGAAAAGGG - Intergenic
973859604 4:55049074-55049096 ATGCTAGTGGGAATGTAAAATGG + Intergenic
973943937 4:55938660-55938682 ATGCTTGTTTTGGTGAGAAAAGG + Intergenic
974116062 4:57580485-57580507 CTGCTAGAGTCCATGAAAAATGG - Intergenic
976697392 4:87932126-87932148 CTGTTAGTGGTGATGCAAAATGG + Intergenic
976770224 4:88644168-88644190 TTGCTGGTGTTAATGCAAAATGG + Intronic
976852585 4:89565289-89565311 TTGCTAGTGGTAATGCAAAATGG - Intergenic
977776616 4:100928549-100928571 GTCTTAGTGTTGATGAAATATGG - Intergenic
979120883 4:116899475-116899497 TTGCTAGTGTTGATAACAAAGGG - Intergenic
980881485 4:138714272-138714294 ATGGTAGTGTTTATGTAGAAAGG + Intergenic
981423477 4:144577830-144577852 AAGATATTGTTGATGAAATATGG + Intergenic
981707452 4:147675979-147676001 ACGCTATTTTTGATGACAAAAGG + Intronic
981898213 4:149830056-149830078 ATGATAGTGTTTTTTAAAAACGG - Intergenic
982270108 4:153577801-153577823 ATGATAGGGTTGATGAATAATGG + Intronic
982700125 4:158651545-158651567 ATGCTAGTGCTGAAAAAGAATGG - Intronic
982799247 4:159683084-159683106 TTGCTGGTGAAGATGAAAAATGG + Intergenic
983488421 4:168359395-168359417 ATGATAGTGTTAATGAAAGTAGG - Intronic
984336631 4:178400643-178400665 ATGCTTGTGTTGCTGAGAAAGGG + Intergenic
985533960 5:452586-452608 ATGTTTTTGTTGTTGAAAAATGG + Intronic
987089808 5:14500586-14500608 AGGCTTCTGTTGATGAGAAAAGG + Intronic
988010717 5:25479278-25479300 ATGCTAGTGTAGATGGAATATGG + Intergenic
988655133 5:33202669-33202691 TTGCTAGTGGCGATGTAAAATGG - Intergenic
989481343 5:41933694-41933716 ATGATAGTGATGATGATATAAGG + Intronic
989632339 5:43498307-43498329 ATTTTAGAGTTGATGAAATAGGG - Intronic
990918317 5:60934926-60934948 ATGCTAGTGGTAATAAAAATAGG - Intronic
991382663 5:66047512-66047534 CTGCTAGTGGTAATGTAAAATGG + Intronic
991405462 5:66296913-66296935 TTGCTAGTGGGGATGCAAAATGG - Intergenic
992480400 5:77145856-77145878 GTGCTACTTTTCATGAAAAAAGG + Intergenic
992583908 5:78212642-78212664 ATTCAAGTGTTGATGGTAAAAGG + Intronic
993153470 5:84191056-84191078 CTGCTAGTGTAAATGAAAAAGGG - Intronic
993351963 5:86861352-86861374 ATGCTAGTTTAGAAGAACAAAGG - Intergenic
994827807 5:104738124-104738146 ATGCTATTTTTGAGGGAAAATGG + Intergenic
995886114 5:116895815-116895837 ATGCTAGGTTTGATGAAAAATGG + Intergenic
995941038 5:117584431-117584453 ATGATACTGTTGGTGATAAAAGG + Intergenic
996208974 5:120781371-120781393 ATGCTACTTTTGATGAAAATGGG + Intergenic
996552547 5:124745392-124745414 ATCCTTGTGTTGTTGATAAAGGG - Exonic
996756307 5:126939148-126939170 ATGCTAGGGTTGATTATAACAGG + Intronic
997049732 5:130365215-130365237 ATGCCTGTGTTTATTAAAAAAGG - Intergenic
997083545 5:130769483-130769505 ATGCTATTGAAGATGCAAAAAGG + Intergenic
998356773 5:141544782-141544804 TTGCTAGTGGAAATGAAAAATGG + Intronic
998652443 5:144136033-144136055 ATGCTAGTGTCCTTGAAAAAAGG - Intergenic
999185757 5:149707328-149707350 CTGCTACTGTTCATGAGAAAGGG + Intergenic
999549988 5:152676189-152676211 GTACTAGTGTTAATAAAAAAAGG - Intergenic
1000308937 5:160022715-160022737 ATACTAGTTAGGATGAAAAATGG - Intronic
1001827678 5:174759099-174759121 ATGCTAGTGTCGATGCCATAGGG + Intergenic
1003075425 6:2979814-2979836 TTACTATTGTTGATGAAAAGAGG - Intergenic
1003262476 6:4532097-4532119 ATGCTAATGTTGACTAATAAGGG - Intergenic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1003750589 6:9050683-9050705 CTGCAAATGTTGATGAAAATGGG + Intergenic
1003765993 6:9237340-9237362 ATGCTAATGTTTAATAAAAATGG + Intergenic
1004152099 6:13131108-13131130 ATGGTAGTTTTGATCATAAAGGG - Intronic
1004432035 6:15554126-15554148 ATGCTAGGCTTGATGAAGAGTGG - Intronic
1005311108 6:24560302-24560324 TTGCTAGTGGGGATGTAAAATGG - Intronic
1005912341 6:30322103-30322125 ATGCTGGTGTGGATAAAAATAGG + Intergenic
1008414387 6:51222889-51222911 ATGCTAGTGGAAATGTAAAATGG - Intergenic
1008445158 6:51580677-51580699 AGGCTAGTGGTGAAGAAAAAGGG + Intergenic
1009817057 6:68749532-68749554 ATTCTAATGTTGAATAAAAATGG + Intronic
1009897702 6:69773811-69773833 ATGCTAGTGTTGATGAAAAATGG - Intronic
1010011910 6:71057697-71057719 ATGCTAGGCTTGATGAAGAATGG + Intergenic
1010295206 6:74187802-74187824 ATGCTAGTTTTGATCTGAAATGG + Intergenic
1011286315 6:85727946-85727968 ATGCCAGTGGAGATTAAAAATGG + Intergenic
1013923501 6:115439785-115439807 ATGCTAGTGCTATTGAAAAGTGG + Intergenic
1014237571 6:118976936-118976958 ATGCTAGTAGGGATGGAAAATGG + Intronic
1014672633 6:124325295-124325317 TTGCTAGTGGGGATGTAAAATGG + Intronic
1015049029 6:128816566-128816588 ATCCAAGTGTTGAAGAATAACGG + Intergenic
1015752958 6:136579363-136579385 GGGGTAGTGTTGATGAAACAAGG - Intronic
1016632978 6:146253419-146253441 ATTTTATTGTTGATGAAAAATGG + Intronic
1017195233 6:151693548-151693570 ATGCTTCTGTTGATGTGAAAGGG - Intronic
1018699612 6:166416187-166416209 ATGGTAGGGTTGATGGAGAAAGG - Intronic
1020333950 7:7047156-7047178 TTGCTAGTAATGATGAACAAGGG - Intergenic
1020491979 7:8797905-8797927 ATGCTAGTTTTAAGGAGAAAAGG - Intergenic
1020951504 7:14684471-14684493 ATGATAGTCCTGATAAAAAAGGG - Intronic
1021059733 7:16096407-16096429 ATAAAAATGTTGATGAAAAATGG + Intronic
1021301898 7:18983689-18983711 TTGCTAGTGGGAATGAAAAATGG - Intronic
1021988550 7:26120471-26120493 ATGTAAGTGTTGATTAGAAAAGG - Intergenic
1022023785 7:26426828-26426850 AAGCTTGTGTGGATGAACAAAGG + Intergenic
1022179314 7:27903086-27903108 ATGCTAGTGTAGATGGCAGAAGG - Intronic
1024244791 7:47461058-47461080 ATGCTGGAGTTGAAAAAAAACGG + Intronic
1024824463 7:53374821-53374843 ATACTAGAGTTGAAGAAATAAGG - Intergenic
1024954747 7:54905551-54905573 CTGTTAGTGTTGCTGGAAAAAGG - Intergenic
1025101291 7:56137179-56137201 TTGCTAGTGGTGGTGAAGAAGGG + Intergenic
1027525965 7:79269021-79269043 ATGGTGGAGTTGATGAAAGAGGG + Intronic
1027967754 7:85034861-85034883 CTGCTAGTGGTAATGCAAAATGG + Intronic
1028181309 7:87728710-87728732 ATGCTACTGAAAATGAAAAAGGG - Intronic
1028281274 7:88932118-88932140 ATGCTAGGCTTGATGAAGAGTGG + Intronic
1028695248 7:93702724-93702746 ATGCTAGTTTTGAAAAGAAATGG + Intronic
1031007521 7:116490520-116490542 ATTCTAATGTTGATGGAATATGG - Intronic
1031128876 7:117807765-117807787 ATGCTTCTGCTGATGAGAAATGG - Intronic
1031206679 7:118767658-118767680 ATGTCAGTGTGGAAGAAAAAAGG + Intergenic
1031546618 7:123058577-123058599 ATGCTAGTGTTGGGAAAGAATGG - Intergenic
1032877767 7:136056133-136056155 AAGCAAGTTTTGATGAAAGAGGG + Intergenic
1033370723 7:140704999-140705021 AAACTAATGTTTATGAAAAAAGG - Intronic
1033393571 7:140951826-140951848 TTGCTGGTGGTGATGTAAAATGG + Intergenic
1033712759 7:143965778-143965800 ATGCTATTGTACATGACAAAAGG - Intergenic
1033892183 7:146027115-146027137 AAGCTAGTTTTGAGGATAAAGGG + Intergenic
1034486704 7:151369819-151369841 ATCCTAGTGTTTAGCAAAAAGGG - Intronic
1034738162 7:153448027-153448049 TTGCTATTTTTAATGAAAAACGG - Intergenic
1036746219 8:11412063-11412085 AAGCGAGTCTTGGTGAAAAAGGG - Intronic
1037655587 8:20881404-20881426 AAGCTACTGTTGAGGAAGAATGG - Intergenic
1037809920 8:22081128-22081150 ATGCTAGTGGTGACCAACAAGGG + Exonic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041136030 8:54760273-54760295 GAGCTAGTCTTGATGAACAAGGG - Intergenic
1041202077 8:55459813-55459835 TTGCTAGTGATGAAGTAAAATGG + Intronic
1041298073 8:56381976-56381998 ATTCCAGTGTTGATGAAATGTGG + Intergenic
1042309142 8:67363165-67363187 ATGCTATTATTTATGCAAAATGG + Intergenic
1043105350 8:76102873-76102895 ATGCTAGTGGGAATAAAAAATGG - Intergenic
1044003100 8:86909263-86909285 ATGCTAGTTTTTATGTAAATAGG + Intronic
1044651527 8:94500600-94500622 CTGCTAGTGGGAATGAAAAATGG + Intronic
1045092798 8:98764100-98764122 AGGCAAATATTGATGAAAAATGG - Intronic
1045161206 8:99547121-99547143 ATGCTAGTTTAGATAAAAAAGGG + Intronic
1047902206 8:129435573-129435595 ATACTACTTTTTATGAAAAAGGG + Intergenic
1047988835 8:130264543-130264565 TTGCTAGTATTGATCAAGAAAGG - Intronic
1049027234 8:140001770-140001792 CTGCTAGTAGTGATGGAAAATGG + Intronic
1050506242 9:6352297-6352319 ATGCTAGGTTTGATGAAGAATGG - Intergenic
1051732320 9:20157802-20157824 ATGCTAATGGTGATGGAAACAGG - Intergenic
1053852059 9:42299124-42299146 AGGCTTGTGTTGATGTTAAATGG - Intergenic
1054571975 9:66820879-66820901 AGGCTTGTGTTGATGTTAAATGG + Intergenic
1054860199 9:69944100-69944122 ATGAAAGGGTTGATGAGAAAGGG + Intergenic
1055003185 9:71476921-71476943 ATGATAATATTGTTGAAAAAGGG - Intergenic
1055008578 9:71537454-71537476 ATGTTACTGATGATGAAAACTGG - Intergenic
1055078822 9:72246530-72246552 ATGCTAGGTTTGATGAAGAGTGG + Intronic
1055172112 9:73271398-73271420 ATGCTTTTGTTGTTGAAACAAGG + Intergenic
1055206554 9:73737681-73737703 GTACTAGTGTGGATGAAGAAAGG + Intergenic
1056624384 9:88242550-88242572 TTGCTACTGTTAATGAAAAATGG + Intergenic
1056739205 9:89238222-89238244 CTGCTAGTGGGGATGTAAAATGG + Intergenic
1056748855 9:89330039-89330061 ATTATGATGTTGATGAAAAAAGG + Intronic
1056978166 9:91280574-91280596 AAGCTAATTTTAATGAAAAAAGG + Intronic
1057251252 9:93504684-93504706 ATTCTACTGTTGATGGAAAATGG + Intronic
1057301232 9:93884906-93884928 TTGCTAGTGATAATGCAAAATGG + Intergenic
1058336187 9:103832386-103832408 ATACTAGTGTTCAGGAAAAAAGG + Intergenic
1058383994 9:104411059-104411081 TTGCCAGAGTTTATGAAAAATGG + Intergenic
1058498849 9:105590520-105590542 ATGGTAGAGTTGGTGAGAAATGG + Intronic
1058533399 9:105929714-105929736 CTCCAAGTGTTGATTAAAAATGG + Intergenic
1059688320 9:116659264-116659286 ATGCAAATGTTCATTAAAAATGG - Intronic
1059939900 9:119348535-119348557 TTGCTAGTGGGGATGCAAAATGG - Intronic
1060438443 9:123616365-123616387 ATGCTACTGTCGACAAAAAATGG + Intronic
1060455987 9:123798117-123798139 ATGCCAGTGTTGGGGGAAAATGG - Intronic
1185559399 X:1047946-1047968 ATGCTAGCGTTAAAGACAAATGG - Intergenic
1186478236 X:9875711-9875733 ATGCTAGAGATGATGTGAAAGGG - Intronic
1186796826 X:13054967-13054989 ATCCTAGTGTTTATGAAGTAAGG + Intergenic
1186962916 X:14757072-14757094 ATGCTAGTGTGGATGTAGAGAGG + Intergenic
1187858750 X:23661921-23661943 TTGCTGGTGTGAATGAAAAATGG + Intergenic
1189574177 X:42332923-42332945 TTGCTGGTGGTGATGCAAAATGG - Intergenic
1190450219 X:50571923-50571945 TTGTTAGTGGGGATGAAAAATGG - Intergenic
1190842943 X:54163063-54163085 TTGCTAGTGGGAATGAAAAATGG + Intronic
1191931938 X:66383214-66383236 AAGCTAGAGATGTTGAAAAAGGG - Intergenic
1192082973 X:68065989-68066011 ATGCTAGGGTTAATAAATAAAGG - Intronic
1193813534 X:86080046-86080068 AGGGTAGGGTAGATGAAAAAAGG + Intergenic
1195263300 X:103154999-103155021 CTGCTGGTGGTTATGAAAAATGG - Intergenic
1195290439 X:103427493-103427515 AAGCTATTTTTGATGAAAAGGGG - Intergenic
1195807119 X:108786737-108786759 TTGCTAGTGTGAATGCAAAATGG - Intergenic
1196646383 X:118122264-118122286 CTGCTACTGTGAATGAAAAATGG + Intergenic
1197004338 X:121478468-121478490 ATTCTACTGTTTATGAAAAGAGG + Intergenic
1197240939 X:124122710-124122732 AGGGTGGTGTTGAAGAAAAAGGG + Intronic
1197598520 X:128496943-128496965 TTGCTGGTGGTGATGTAAAATGG - Intergenic
1198867319 X:141138158-141138180 TTGCCAGTGTGGATGCAAAATGG + Intergenic
1201354610 Y:13083971-13083993 CTGCTACTGTTGATGCAAAGTGG - Intergenic