ID: 1009905973

View in Genome Browser
Species Human (GRCh38)
Location 6:69869892-69869914
Sequence CTGAGGAAATGTAATAGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009905970_1009905973 26 Left 1009905970 6:69869843-69869865 CCTCTGGAATGTAGACACTAGTT 0: 1
1: 0
2: 0
3: 15
4: 139
Right 1009905973 6:69869892-69869914 CTGAGGAAATGTAATAGAGTTGG No data
1009905969_1009905973 27 Left 1009905969 6:69869842-69869864 CCCTCTGGAATGTAGACACTAGT 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1009905973 6:69869892-69869914 CTGAGGAAATGTAATAGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009905973 Original CRISPR CTGAGGAAATGTAATAGAGT TGG Intronic
No off target data available for this crispr