ID: 1009909305

View in Genome Browser
Species Human (GRCh38)
Location 6:69905476-69905498
Sequence CATCTTTGCAGATGAACAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 6, 3: 26, 4: 220}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009909305_1009909309 5 Left 1009909305 6:69905476-69905498 CCCGCTGTTCATCTGCAAAGATG 0: 1
1: 0
2: 6
3: 26
4: 220
Right 1009909309 6:69905504-69905526 CTTTGACTCTCTGTTTCTCTGGG No data
1009909305_1009909308 4 Left 1009909305 6:69905476-69905498 CCCGCTGTTCATCTGCAAAGATG 0: 1
1: 0
2: 6
3: 26
4: 220
Right 1009909308 6:69905503-69905525 GCTTTGACTCTCTGTTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009909305 Original CRISPR CATCTTTGCAGATGAACAGC GGG (reversed) Intronic
900303372 1:1989188-1989210 CGTCTTTGCAGACGGACAGCGGG + Intronic
902190115 1:14756449-14756471 CATCTCTGCGGATGAGCAGGAGG + Intronic
904042669 1:27593440-27593462 CATCTTTGCCCATGGACACCAGG - Intronic
906372519 1:45266327-45266349 CATCTTTGCAGACAGACAGAGGG - Intronic
907674064 1:56502557-56502579 AATCTGTGGAGATGAACAGATGG + Intronic
908606837 1:65807236-65807258 AATCTATGCAGAGGGACAGCTGG - Intronic
911369419 1:96978758-96978780 CCTCTTTGCAGAGGAACAGTAGG + Intergenic
913198452 1:116476932-116476954 CATCTTTGCCCATGAAGAACAGG - Intergenic
914456966 1:147845320-147845342 CATCTTTGCAGATGGACAGAGGG + Intergenic
914825988 1:151138304-151138326 CATCTTTGCAGGTGTGCAACTGG - Exonic
915724351 1:158007235-158007257 CTTCTGTGCAGATGCACAACAGG - Intronic
916243830 1:162666647-162666669 CATGGTTGCAGCTGAATAGCTGG + Intronic
916653044 1:166848693-166848715 CTTCTTTGCAGATGAAGAAGGGG - Intronic
919644671 1:200082816-200082838 GACCTTTGTAGATGCACAGCAGG - Intronic
920693182 1:208162286-208162308 CCTCTTTGGAGAAGAACAGATGG - Intronic
921247409 1:213259109-213259131 AAACTATGCAGATGAACAGAAGG + Intronic
921349222 1:214218529-214218551 CTTTTCTGCAAATGAACAGCAGG - Intergenic
921790690 1:219286998-219287020 CATCTTTCCAGTTGAATGGCAGG + Intergenic
924581832 1:245330384-245330406 CATGTGTGAAGATGAGCAGCAGG + Intronic
1063559282 10:7111521-7111543 CATCCTTCCAGAAGAACAGGGGG - Intergenic
1064142563 10:12802953-12802975 CATCTTTGCAGTGGCACATCTGG + Intronic
1064365291 10:14702045-14702067 CTTCTTTTCAGATGAAGAGCAGG + Intronic
1068581812 10:58749664-58749686 CATCTTTGTAGATCCACAGTGGG - Intronic
1073839484 10:107482151-107482173 TGTCTTTGCAGATGAACGGAGGG - Intergenic
1075394801 10:122119611-122119633 CATCTTTTGAGAAGAACATCAGG + Intronic
1075442979 10:122494199-122494221 CATCTCTGCAGCTGGACTGCGGG + Intronic
1076915489 10:133421403-133421425 CAACTTTGCAGATGCCCACCTGG - Exonic
1079738771 11:24031690-24031712 TTTTTTTGCATATGAACAGCCGG + Intergenic
1079968412 11:27006614-27006636 CATCTTTGCAGATGGACAGGAGG + Intergenic
1080233605 11:30045035-30045057 CATCTTTACAGATGGACGGAGGG + Intergenic
1080771387 11:35345427-35345449 CCTCTTTGCAGAGGAAGTGCTGG + Intronic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1084918364 11:72448803-72448825 CATCTGTGCAGCTGAGCATCTGG - Intergenic
1085792873 11:79511026-79511048 CTGCTTTGCTGATGGACAGCAGG - Intergenic
1086886595 11:92213360-92213382 CATCTTGTCAGGTGAAAAGCAGG + Intergenic
1087066170 11:94029943-94029965 CCTCTTAGCAGATTAAAAGCAGG + Intronic
1089971282 11:122695439-122695461 CATGTTTGCAGAGGAGGAGCCGG - Intronic
1090277155 11:125428364-125428386 CCACTTTGCAGATGAAGAGATGG - Intronic
1091274406 11:134340638-134340660 CATCCTTGCAGATGAAGCCCTGG - Intronic
1091638174 12:2213939-2213961 CTTCTCTGCAGTTGATCAGCAGG + Intronic
1091826818 12:3519121-3519143 CGTCTTTGCAGACGGACAGAGGG + Intronic
1093287819 12:17287120-17287142 AAACTATCCAGATGAACAGCAGG - Intergenic
1094177038 12:27551592-27551614 AGTCTCTGGAGATGAACAGCTGG + Intronic
1094288442 12:28819104-28819126 TGTCTTTGCAGATGGACAGAGGG + Intergenic
1094539556 12:31351840-31351862 CATCTTTCCAGAGGAGCAGAGGG - Intergenic
1098278630 12:68839752-68839774 CTTCTTTGCACATGTAAAGCAGG - Exonic
1099034925 12:77574421-77574443 AATCTTTGTAGATGAAGTGCTGG + Intergenic
1099909122 12:88808113-88808135 AATCTATGCAGATATACAGCAGG - Intergenic
1100794238 12:98163778-98163800 CATCTATGGAGATAAGCAGCAGG + Intergenic
1101016642 12:100508018-100508040 TCTCTTTACAGATGAACAGAGGG + Intronic
1102349683 12:112183357-112183379 CATCTCTGCAGATGAATAGAGGG - Intronic
1103440185 12:120957233-120957255 CATCTCTGCAGAGTGACAGCAGG - Intergenic
1104191823 12:126489077-126489099 TATCTTTCCATTTGAACAGCAGG - Intergenic
1104205468 12:126634481-126634503 CAAGTTTGGAGAGGAACAGCTGG - Intergenic
1104402145 12:128485106-128485128 CATCATTTCAGATGGGCAGCAGG - Intronic
1107276517 13:38686546-38686568 CATATTTGCAAAAGGACAGCTGG - Intergenic
1107502276 13:40992754-40992776 CATCTTTTCAGATGAATTCCAGG - Intronic
1108591149 13:51913943-51913965 CATGTTTGCAGCTGTGCAGCAGG - Intergenic
1112240884 13:97680006-97680028 GATCTCTGCAGAGGAAAAGCTGG - Intergenic
1112918786 13:104583968-104583990 CAACTTGGCAGATGATCTGCTGG + Intergenic
1113280341 13:108781592-108781614 TGTCTTTGGAGATGAACAGAGGG - Intronic
1114362318 14:21988227-21988249 CATCTTTGCAGATGAATAAATGG - Intergenic
1115707747 14:36015439-36015461 CATCTTTGCAGACAGACAGAAGG - Intergenic
1116411312 14:44626847-44626869 CATCTTTGAAGACGGACAGTGGG + Intergenic
1118326227 14:64783117-64783139 CATCTATGCAGATGAAAACCAGG - Intronic
1118843931 14:69532335-69532357 CATCCTTCCAGATGAATAGAGGG - Intergenic
1120617532 14:86726178-86726200 CAGCTTTGCAGATGAAAATTAGG + Intergenic
1121461148 14:94079610-94079632 TATGTTTGCAGATGGACAGATGG - Exonic
1122502624 14:102211411-102211433 CATGTTTGCAGATGGGAAGCAGG - Intronic
1123883413 15:24697115-24697137 CGTCTTTGCAGACGGACAGAGGG - Intergenic
1124230204 15:27938433-27938455 CACTTTTGCTGATGAAAAGCTGG - Intronic
1126400289 15:48261617-48261639 CATCTTTGCAAAGAAACAGATGG + Intronic
1126926223 15:53589782-53589804 CATCTTGGCATATGAAAAACTGG - Intronic
1127802388 15:62488481-62488503 CATCCTTGCAGACCACCAGCAGG + Intronic
1128763500 15:70236063-70236085 CATCTTTGCAGATAAAGAAATGG + Intergenic
1129273065 15:74429449-74429471 CATCTCTGCAGAGGAAGAGCAGG + Intronic
1130776462 15:86989498-86989520 CATCTTAGCAGATTAAAAGGGGG - Intronic
1137963673 16:52910412-52910434 AATGTTTGCTGATGAACAGAAGG - Intergenic
1141387016 16:83631037-83631059 CATCTCTGCCGCAGAACAGCTGG + Intronic
1141740677 16:85890227-85890249 TACCTTTGCAGATGTGCAGCAGG - Intergenic
1142931584 17:3289521-3289543 GATCTTTGGAGATAAACAGCAGG + Intergenic
1143201996 17:5119789-5119811 CATCTCAGCTGATAAACAGCTGG + Intronic
1143823863 17:9588321-9588343 CATCTTTGCAGATGGACAAGGGG + Intronic
1144568818 17:16382036-16382058 CATCTTTGCAGGCAAGCAGCTGG + Exonic
1144568854 17:16382264-16382286 CATCTTTGCAGGCAAGCAGCTGG + Exonic
1144568890 17:16382492-16382514 CATCTTTGCAGGCAAGCAGCTGG + Exonic
1144734993 17:17550367-17550389 GAGCTTTGCAGATGCACAGCTGG + Intronic
1145360013 17:22204221-22204243 CATCTTTGCAGGCAAGCAGCGGG + Exonic
1145360049 17:22204449-22204471 CATCTTTGCAGGCAAGCAGCTGG + Exonic
1145360082 17:22204676-22204698 CATCTTTGCAGGCAAGCAGCTGG + Intronic
1148054440 17:44785791-44785813 AATCTTTCCAGAAGATCAGCAGG + Intergenic
1148485602 17:47988843-47988865 CATTTTTGGAGTTGAACATCTGG - Intergenic
1153301984 18:3599302-3599324 CAATTTTGCAGATGAAAAGGAGG + Intronic
1156218423 18:35026700-35026722 CACCTTGGCACAGGAACAGCGGG - Intronic
1156289223 18:35730995-35731017 CGTCTTTGCAGATGGACAGGAGG - Intergenic
1156305999 18:35878729-35878751 CAACTTTGAAAATGAACTGCTGG + Intergenic
1157130352 18:45001587-45001609 CATCTTTGAGGAGGAGCAGCAGG + Intronic
1157398162 18:47361090-47361112 CATCTTTGTAGAAGAACAGTTGG + Intergenic
1160580387 18:79880846-79880868 CATCTGTTGAGATGAACAGCTGG - Intronic
1164691579 19:30214683-30214705 CATCTTTTCACAAGTACAGCAGG - Intergenic
1165289855 19:34874342-34874364 CATCCTTGCAGATGAGGAGTGGG + Intergenic
1168323594 19:55525658-55525680 CATCCCTGCAGGTTAACAGCAGG + Intergenic
925456443 2:4020540-4020562 CATCTTTGCAGACGGACAGGAGG + Intergenic
925804422 2:7634046-7634068 TATCTTTGAAGGTGGACAGCTGG - Intergenic
926765924 2:16322712-16322734 CATCTTGGGAGAAGAACTGCAGG - Intergenic
927456738 2:23258429-23258451 AATCTTTGCAGAAAAACAGCTGG - Intergenic
928132678 2:28664463-28664485 CGTCTTTGCAGATGAACAGAGGG + Intergenic
929329539 2:40664141-40664163 CATCATTGCTCATGAACTGCAGG + Intergenic
931563722 2:63591262-63591284 CAACATTGCAGTTGAAAAGCAGG - Intronic
933393975 2:81708278-81708300 CTTTTTTACAGATGACCAGCTGG + Intergenic
933525059 2:83426831-83426853 CATCTTTCAAGATGGTCAGCAGG + Intergenic
935191157 2:100779770-100779792 TATCTCTGCAGAAGGACAGCTGG - Intergenic
935633969 2:105235697-105235719 CCTCTTTACAGATGAAGAACTGG - Intergenic
935998847 2:108804385-108804407 CATATTTTGAGATGAAAAGCAGG + Intronic
936025835 2:109030582-109030604 CCTCTTTGAGGATGACCAGCAGG + Intergenic
936445916 2:112595158-112595180 CACCATTGCAGATGCAAAGCAGG + Intergenic
936496502 2:113026488-113026510 CTTCTTTGCACATGACAAGCAGG - Intronic
937733219 2:125259586-125259608 CATCTTTGCAGACAGGCAGCGGG - Intergenic
937826665 2:126374171-126374193 CATCTTTGCAGATGGACAGTGGG + Intergenic
938386710 2:130872008-130872030 CCATTTTGCAGATGCACAGCTGG - Intronic
938959614 2:136329524-136329546 CATCTTTGCAGGCAAGCAGCTGG - Intergenic
941021984 2:160417658-160417680 CATCTCTGCAGTTGAAATGCAGG - Intronic
941668993 2:168270706-168270728 TATCTTTGCAGATAGACAGAGGG - Intergenic
942185384 2:173420427-173420449 CCCCTCTGAAGATGAACAGCAGG - Intergenic
942389791 2:175479896-175479918 CATCTGGGCAGATTAACAGGTGG + Intergenic
1169023933 20:2351335-2351357 TAGCTTTGCAGATGAGAAGCTGG - Intergenic
1173859518 20:46273736-46273758 CATCTTGGCAGATGAGCCACCGG + Intronic
1174407523 20:50311832-50311854 CATCTTTGGAGTTGAGCTGCAGG + Intergenic
1174532994 20:51229584-51229606 CATCTTTGCTGACGAACAGAGGG + Intergenic
1175297581 20:57919625-57919647 CATCTATACAAATTAACAGCTGG - Intergenic
1175539025 20:59736685-59736707 CATCACTGCAGGTGTACAGCGGG - Intronic
1175939369 20:62530979-62531001 GATGATTGCAGATGATCAGCCGG - Intergenic
1179012563 21:37567227-37567249 CATCTTTGCAGATGGACAGAGGG + Intergenic
1179562613 21:42225675-42225697 CATCTCTGCAGAGTAACTGCTGG - Exonic
1182931212 22:34176077-34176099 CATTCTGGCAGATGCACAGCAGG + Intergenic
1182981359 22:34674436-34674458 CATTTTTTTAGAAGAACAGCAGG + Intergenic
1184423551 22:44395762-44395784 CATCTTTGCACATTATCTGCGGG - Intergenic
1184665818 22:45988552-45988574 CATCTCTGCAGATGAGGATCTGG + Intergenic
1184666992 22:45994525-45994547 CAGAGTTGCAGATCAACAGCTGG + Intergenic
949332342 3:2936355-2936377 CATCTTTGAAGATGGAGAGTGGG - Intronic
951744096 3:25957776-25957798 GAACTCTGAAGATGAACAGCTGG + Intergenic
952848147 3:37705903-37705925 CTTCTTTCCAGATGAACAAATGG - Intronic
954214392 3:49116347-49116369 CATCCCTGCAGAGGCACAGCAGG + Exonic
954316619 3:49804951-49804973 CATCATTGCAGATGATGGGCTGG - Exonic
954753784 3:52828088-52828110 CATCTCTCCAGATGGCCAGCTGG + Intronic
955716613 3:61836400-61836422 CATCTTTGTAGATCAACACCAGG - Intronic
956358141 3:68416581-68416603 GATCTTAGCAGGTGAACTGCCGG - Intronic
957573822 3:81984169-81984191 CATGTTTGTAGAAGAAAAGCAGG + Intergenic
957612752 3:82489809-82489831 ACTCTTTGCAGTTGAAGAGCAGG - Intergenic
958556023 3:95678292-95678314 AATCTTTGCTGCTGCACAGCTGG + Intergenic
960595426 3:119403879-119403901 CAGCTTTGCAGATGAGAAACAGG - Intronic
960982566 3:123244342-123244364 CACCTTTGCTGAAGGACAGCTGG - Intronic
962281901 3:134058448-134058470 CAGCTGTGCAGCTGCACAGCTGG + Intergenic
962392371 3:134983913-134983935 CTACTTTGCAGATGAATTGCGGG - Intronic
963960106 3:151300309-151300331 GCTCTTTGGAGATGAACACCTGG + Intronic
966371176 3:179252129-179252151 CGTCCCTGCAGATGAACAGCGGG + Intronic
968050595 3:195652202-195652224 CATGGTGGCAGATGAACATCAGG - Intergenic
968303519 3:197633728-197633750 CATGGTGGCAGATGAACATCAGG + Intergenic
968542431 4:1174812-1174834 CATCTCAGCAGATGAAGTGCTGG - Intronic
969668884 4:8578755-8578777 CATCCTTGCAGATGAGCAAATGG + Intronic
969668932 4:8579044-8579066 CAAGTTTGCAGGTGAATAGCTGG - Intronic
970016965 4:11522353-11522375 CATACTTACAGATGAAGAGCCGG - Intergenic
970025864 4:11623396-11623418 CAGCATTTCAGATGTACAGCAGG - Intergenic
970240791 4:14006587-14006609 CTACTTTGCAGATGAACAAACGG + Intergenic
972119726 4:35685347-35685369 CATCTTTGAATATGAAAAACTGG + Intergenic
972411862 4:38802978-38803000 CATCTTTGCAGATGGACTGAGGG + Intronic
972991885 4:44830659-44830681 CATCTTTGCAGGTGGGCAGGAGG + Intergenic
973739829 4:53909141-53909163 CATTTTTGCAGATGAGGACCAGG + Intronic
973921834 4:55694696-55694718 CATCTATTCAGATGAACATGTGG - Intergenic
976410183 4:84704395-84704417 AATCATTGCAGATGAATAGTGGG + Exonic
976886902 4:89996318-89996340 CTTTTTTGCAAATGAAAAGCAGG - Intergenic
977012288 4:91652881-91652903 GCTCTTTGCAGATGAATTGCTGG + Intergenic
977519314 4:98060774-98060796 CAGCTTTGCAGAAGATCAGGTGG - Intronic
979129917 4:117030990-117031012 CATATTTGCTGATGGACATCAGG - Intergenic
979438391 4:120721973-120721995 CGTCTTTGCAGAGGGACAGAGGG + Intronic
984537967 4:181000723-181000745 CATCTTTGCAGAGATACAGTTGG - Intergenic
985206817 4:187547310-187547332 GATCTTTGCAAAAGAACTGCCGG + Intergenic
986299818 5:6469207-6469229 CATGTGTCCAGATGCACAGCTGG + Intronic
987002668 5:13675962-13675984 CATCTATGTGGATGAACAGGAGG + Intergenic
987553971 5:19421380-19421402 AATATTTGCAGATGAATAGATGG - Intergenic
989456485 5:41650046-41650068 TATCTTTGCAGATGGACAGAGGG + Intergenic
989711375 5:44401484-44401506 CATCTTTTCAGATGAAGAGAAGG - Intergenic
991170572 5:63620196-63620218 CATCTTAACAGATTAAGAGCAGG + Intergenic
994659614 5:102637981-102638003 CATCTATTCAGATGACCAGAGGG - Intergenic
995688823 5:114800556-114800578 CATTTTTGCAGCTGAAAAGGTGG - Intergenic
996856898 5:128018469-128018491 CATCCATGCAGATGATCAGCTGG + Intergenic
997665413 5:135626285-135626307 CCACTTTGCAGAAAAACAGCTGG - Intergenic
997717569 5:136053388-136053410 CCTCTTTGCCCATGCACAGCAGG - Intronic
999645657 5:153714623-153714645 CTTCTTTGCAGGTGAACAACTGG - Intronic
1000733399 5:164866117-164866139 CATCCTCCCAAATGAACAGCAGG + Intergenic
1002330594 5:178437773-178437795 CATCTTGGCTGATGAACATTGGG - Intronic
1003527082 6:6907252-6907274 CATCTTTGCTGAAGAATACCGGG - Intergenic
1005562949 6:27060051-27060073 CCTCTTTGCAGATAGACAGTGGG - Intergenic
1005642390 6:27808461-27808483 CATCGTTGCGGATGGCCAGCTGG - Exonic
1005642958 6:27814467-27814489 CATCGTTGCGGATGGCCAGCTGG + Exonic
1007825578 6:44598219-44598241 CATATATGCAGATTAACAGACGG - Intergenic
1009909305 6:69905476-69905498 CATCTTTGCAGATGAACAGCGGG - Intronic
1012494704 6:99821487-99821509 CATCTTTGCAAATGAACAGAGGG + Intergenic
1015848147 6:137543339-137543361 CATTTTTGCAGATGTGCAGGTGG - Intergenic
1016755326 6:147678443-147678465 CAGCTTGGCAGATTAACTGCTGG + Intronic
1017166305 6:151411392-151411414 CCTCTGTGCACATGAGCAGCTGG - Intronic
1018166895 6:161106374-161106396 TATCTATTCAGATAAACAGCAGG - Intronic
1018491499 6:164298496-164298518 CATCTTGGCAGATGAGCTGATGG - Intergenic
1019272461 7:158000-158022 CAGCTTTGCAGATAAAAAGGAGG - Intergenic
1019746426 7:2702759-2702781 CCTCTGTGCAGCTGCACAGCTGG - Exonic
1023413589 7:39911110-39911132 TTTTTTTGCAGATGAACAGAGGG + Intergenic
1024012291 7:45279381-45279403 GATCTAAGCAAATGAACAGCAGG - Intergenic
1024181192 7:46896955-46896977 CAGCTTTGTAGATGAACAGAAGG - Intergenic
1026144983 7:67738817-67738839 CATGTTTTCATATGAACATCCGG - Intergenic
1026566852 7:71496390-71496412 CATCTTTCTAGAGAAACAGCAGG + Intronic
1028894609 7:96027119-96027141 CATGGATGCAGATGAACAGATGG - Intronic
1028899288 7:96078185-96078207 TATCCTTGCATAGGAACAGCTGG - Intronic
1029324620 7:99795509-99795531 CAACTTTGCACATGAACTTCAGG + Intergenic
1029972562 7:104803548-104803570 CAGCTTAGCAGAGGAACAACTGG + Intronic
1033198678 7:139349720-139349742 CATTTGTGAAGAGGAACAGCGGG - Intronic
1034268520 7:149792420-149792442 CGTCTTGGCAGATGCAGAGCTGG - Intergenic
1034434175 7:151055265-151055287 CATCTTTGCAGGTGATGTGCTGG - Exonic
1035136363 7:156707617-156707639 CATCTTTGGAGATGATCATGTGG - Intronic
1038272738 8:26089151-26089173 CATCTGTGCATATGCACACCGGG - Intergenic
1039273277 8:35906675-35906697 TGTCTTTGCAGATGGACAGAGGG - Intergenic
1039319755 8:36415433-36415455 CATATTTGCACATGCACAGCAGG + Intergenic
1041004131 8:53483078-53483100 CATCTTTGCAGACAGACAGAGGG + Intergenic
1041004954 8:53488565-53488587 CATCTTTGCAGATGGACCAAGGG + Intergenic
1041185967 8:55300796-55300818 CATCATTGGAGAAGAACATCTGG + Intronic
1043751468 8:83941548-83941570 CATCTTTTGAGATGATCATCTGG + Intergenic
1044727389 8:95204495-95204517 GGTCTTTGCAGATGGACAGGGGG + Intergenic
1045357457 8:101402410-101402432 GAGCTGTGCAGATGACCAGCTGG - Intergenic
1046024886 8:108710770-108710792 TGTCTTTGCAGATGGACAGTGGG - Intronic
1046198803 8:110894673-110894695 CATCTTTGCAGACAGACAGGGGG - Intergenic
1048259125 8:132930776-132930798 CATCTCTGGACATGAACAGATGG - Intronic
1048705754 8:137151401-137151423 CATTTTTTCAGATTGACAGCAGG + Intergenic
1049235120 8:141508403-141508425 CCTCATTGCAGGCGAACAGCAGG - Intergenic
1052261310 9:26519570-26519592 CACCTTTGCAGATGGGCAGCGGG - Intergenic
1052282029 9:26744019-26744041 CTTCTTGCCTGATGAACAGCAGG - Intergenic
1054963412 9:70994865-70994887 CATGTTTCCAGTTGATCAGCAGG - Intronic
1058367156 9:104221871-104221893 CATTTTTGCAGATGAAGGGAAGG + Intergenic
1059308164 9:113370758-113370780 CATTTCTGCATGTGAACAGCTGG - Exonic
1060055474 9:120409305-120409327 TATGTTTGCAGATAAACAGAAGG - Exonic
1060428673 9:123528120-123528142 CATCATTGCAGATGGAGTGCTGG - Intronic
1061319364 9:129818352-129818374 AATCTTTGCTGATGAACTCCAGG - Intronic
1061562236 9:131412637-131412659 CTTCTTTGCAAATTAACCGCTGG + Intronic
1186935720 X:14448784-14448806 CGTCTTTGCAGATGGACAAGGGG + Intergenic
1187539730 X:20180526-20180548 CATCTTTGCAGGTGTTCACCAGG - Intronic
1188139290 X:26528594-26528616 CATCTTTGTCGAAGATCAGCTGG + Intergenic
1188850653 X:35127955-35127977 CATTGTTTCAGATGAAGAGCTGG - Intergenic
1190383134 X:49858798-49858820 CTTCTTTGCACAGGAAAAGCTGG - Intergenic
1190404779 X:50075958-50075980 CATCTGTGCTGATGATAAGCTGG - Exonic
1192184609 X:68938688-68938710 CCTCTTGGCAGATGCAAAGCTGG - Intergenic
1193015386 X:76726598-76726620 CATCTTTGTCGAAGAACAGTTGG + Intergenic
1195724812 X:107903631-107903653 CCTCTTTCCAAAAGAACAGCAGG + Intronic
1198442695 X:136679347-136679369 CATATTTGCAGATGGACAATGGG + Intronic
1199150656 X:144481617-144481639 CAGCTTTGTAGATGATCAGATGG + Intergenic
1199752375 X:150832508-150832530 CATCTATTGAGATGAATAGCTGG - Intronic