ID: 1009909576

View in Genome Browser
Species Human (GRCh38)
Location 6:69909190-69909212
Sequence CTTTCTAAGGAAAAGAGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 341}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009909571_1009909576 5 Left 1009909571 6:69909162-69909184 CCATTTTCTAGCCTCAAATGTAC 0: 1
1: 0
2: 0
3: 22
4: 158
Right 1009909576 6:69909190-69909212 CTTTCTAAGGAAAAGAGGGTAGG 0: 1
1: 0
2: 4
3: 29
4: 341
1009909572_1009909576 -6 Left 1009909572 6:69909173-69909195 CCTCAAATGTACATAAACTTTCT 0: 1
1: 0
2: 1
3: 30
4: 371
Right 1009909576 6:69909190-69909212 CTTTCTAAGGAAAAGAGGGTAGG 0: 1
1: 0
2: 4
3: 29
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009909576 Original CRISPR CTTTCTAAGGAAAAGAGGGT AGG Intronic
902084314 1:13846906-13846928 CTTTTTAATGAAAAAAGAGTTGG - Intergenic
902383494 1:16063673-16063695 CTTTGTAAGCAAGAGAGGGCTGG - Intronic
902632055 1:17710817-17710839 CTTTCTCTGGAAAAGAAGGGAGG - Intergenic
902927564 1:19706499-19706521 CTTTTTATGTAAAAGAGGGCAGG + Intronic
903033382 1:20479056-20479078 CTTCCTATGGAAATGAGGTTGGG - Intergenic
903088222 1:20883320-20883342 CTTTAGAAGGAAATGAGGGCCGG + Intronic
903989607 1:27257249-27257271 CCTTCTAAGGAAAAGGGTATTGG + Intronic
904527456 1:31144649-31144671 TTTTCAAAGGAAAAGAGGCCAGG + Intergenic
904874218 1:33641720-33641742 GGTTCTAAGGCAAAGAGGGGTGG - Intronic
905833920 1:41100002-41100024 CTTTCCATGGAAAAGAGTGTAGG - Intronic
907578662 1:55552087-55552109 ATTTATAAAGAAAAGAGGTTTGG + Intergenic
907660807 1:56390771-56390793 GGTTTTAAGGAAAAGGGGGTGGG - Intergenic
908424279 1:63990605-63990627 CCTTCTCAGGAATAGAGGTTTGG - Intronic
909396122 1:75172780-75172802 ATTTCTAAGGAAAAGCTGGAAGG - Intergenic
909926921 1:81448444-81448466 ATTTATAAAGAAAAGAGGTTTGG - Intronic
910140373 1:84020625-84020647 CTTTCTGAGGAACAAAGGGAGGG - Intergenic
910472716 1:87572532-87572554 ATTTATAAAGAAAAGAGGTTTGG + Intergenic
910979958 1:92950222-92950244 CATTCTAAGGCAAAGAGGAAAGG + Intronic
911143895 1:94534160-94534182 AATTATAAGGAAAAGAGGCTGGG - Intronic
912667289 1:111593682-111593704 CTTTCTAAGTAAAAAAGGAGTGG + Intronic
912973200 1:114303740-114303762 CTTTTTAACAAAAAGAGAGTAGG + Intergenic
914746355 1:150504450-150504472 CTGTCAAGGGAAAAGAGGATAGG - Intronic
915884218 1:159705409-159705431 CTCTCTAAGGAAAAGACCGGAGG - Intergenic
916001356 1:160619445-160619467 TTTTCTAGGGAAAAGAGTGCAGG - Intronic
918116003 1:181498203-181498225 CTTTTTAAGGAAATGAGGGTTGG + Intronic
919758579 1:201081989-201082011 ATTTATAAAGAAAAGAGGTTTGG - Intronic
920009307 1:202856211-202856233 CTTCCTCAGGAGAAGAGGGTTGG - Intergenic
920573370 1:207035352-207035374 ATTTATAAAGAAAAGAGGTTTGG + Intronic
920739698 1:208568985-208569007 ATTCCTTAGGTAAAGAGGGTCGG + Intergenic
921670207 1:217916582-217916604 CATTCTAAGTAGAAGAGGGATGG + Intergenic
922005469 1:221526303-221526325 CTTTCTAAGGCAAGGAGGGCTGG - Intergenic
922120526 1:222663104-222663126 CTTCCTATGGGAAAGTGGGTTGG - Intronic
923120000 1:230980927-230980949 GTTTCTAATGAAATGCGGGTGGG - Intronic
923660059 1:235950130-235950152 CTTTAAAAGGAAAACAGGCTGGG - Intergenic
924176737 1:241398997-241399019 GTTTCTAAAGAAAAGCAGGTAGG - Intergenic
924691232 1:246353214-246353236 CTTTCTAATTAAAATAGGATAGG - Intronic
1063104698 10:2982874-2982896 CTTTCTATGGATAGGAGGGGAGG - Intergenic
1064122980 10:12635299-12635321 CTTTCTCAAGAAAAGCGGATGGG - Intronic
1064602485 10:17007664-17007686 GATTCTGAGGAAAAGAGGCTAGG + Intronic
1065829677 10:29603279-29603301 CTTTATAAAGAAGAAAGGGTTGG - Intronic
1067130493 10:43560115-43560137 ATTTCTAAGAGGAAGAGGGTGGG - Intronic
1067976652 10:51033356-51033378 CTTTCTAAGGAAACTGAGGTTGG + Intronic
1068160369 10:53254699-53254721 ATTTATAAAGAAAAGAGGTTTGG - Intergenic
1068479270 10:57568910-57568932 CATTCTAAGGAAGTGAGGGGTGG - Intergenic
1069330112 10:67281865-67281887 ATTTCTAAGGAAAAGATCCTTGG + Intronic
1070147124 10:73782464-73782486 CTTTCTCAGGAAAAGAATGGGGG + Intronic
1071302339 10:84265372-84265394 GTTTCTAAGGTAACGAGGGCTGG + Intergenic
1071677322 10:87666876-87666898 ATCTCAGAGGAAAAGAGGGTGGG - Intronic
1072170101 10:92850354-92850376 ATTGCTAAAGAAAAGAGAGTGGG - Intronic
1072463988 10:95646335-95646357 CTGTATCAGGAGAAGAGGGTGGG + Intronic
1073135089 10:101215931-101215953 CTTTTGAAGGAGAAGACGGTGGG - Intergenic
1074351655 10:112743615-112743637 CTTCCAAAGGCAGAGAGGGTTGG - Intronic
1075351294 10:121727016-121727038 TTCTCTCAGGAAAAGAGTGTGGG - Intergenic
1077993020 11:7428903-7428925 CTTTCTAAGGAATAGAAATTGGG + Intronic
1078926841 11:15882880-15882902 CTTTCAAAGGAAAAGAGCAGAGG - Intergenic
1080709695 11:34734831-34734853 CTTTAAAAGTGAAAGAGGGTCGG + Intergenic
1082702168 11:56445430-56445452 CTTTCTAAGGAAAACAAGGGAGG + Intergenic
1083143471 11:60740254-60740276 CTTTCTCTGGAGCAGAGGGTGGG - Intronic
1083161159 11:60854965-60854987 CTTTCTAGGGAAAACACTGTTGG + Intronic
1083877726 11:65533076-65533098 CTTTCCAGGGCACAGAGGGTGGG + Intronic
1084015127 11:66374248-66374270 TTTTTTAAAGAAAAGAGGCTGGG - Intergenic
1084643871 11:70443089-70443111 ATTTCTAAAGAAAAGAGATTTGG + Intergenic
1084856321 11:71989994-71990016 CTTCCCCAGGCAAAGAGGGTGGG - Intronic
1085855693 11:80172974-80172996 TTTTTTAATGAAAAGAAGGTAGG + Intergenic
1086159364 11:83704148-83704170 CTTTCTAAGTAAAAGCTGGCAGG + Intronic
1086854664 11:91851894-91851916 GTTTCTAGAGAAAAGTGGGTAGG + Intergenic
1086933396 11:92718280-92718302 CTTTCTGGGGAGAACAGGGTGGG + Intronic
1089759530 11:120712833-120712855 CCTTCTAAGGAAGAGAAGATCGG - Intronic
1090634626 11:128683317-128683339 CTCTCTCAGGAAAAGAAGGAAGG + Intergenic
1091092415 11:132784422-132784444 CTTTATAATGGAAAGAGGGAAGG - Intronic
1093821301 12:23621627-23621649 ATTTCAAAGTAAAAGAAGGTTGG + Intronic
1094046491 12:26173231-26173253 CTTTCTTTAGAAAAGAGCGTGGG + Intronic
1095226568 12:39685247-39685269 ATTTATAAAGAAAAGAGGTTTGG + Intronic
1095374856 12:41514705-41514727 CTTTGTATGGAAAAGAGGAAAGG - Intronic
1097829897 12:64213149-64213171 CTTTCTGAGCATAAGATGGTTGG - Intronic
1098087393 12:66861497-66861519 TTTTCTAAGCAAAAGAGCATAGG - Intergenic
1098434918 12:70458551-70458573 CTTGGTAAGAAAAAGTGGGTGGG - Intergenic
1099281857 12:80660005-80660027 CTTTCTAAGGTGAAGATTGTAGG - Intronic
1099888110 12:88556552-88556574 GTGACTAATGAAAAGAGGGTAGG + Intronic
1100554173 12:95675854-95675876 CTTGCTAATGAAAGGAGGCTGGG + Intronic
1100755117 12:97742730-97742752 CCTTCTAAGAAGAAGAGGTTAGG - Intergenic
1101272710 12:103164538-103164560 CTGTCTAAGGCACAGGGGGTGGG + Intronic
1101329770 12:103748233-103748255 CATTCTAAGGATGGGAGGGTGGG - Intronic
1103677854 12:122670656-122670678 CCTGCTAAGGAAAGGAGGGGAGG - Intergenic
1105063257 12:133173086-133173108 TCTTCTAAGGAACAGAGGTTGGG + Intronic
1105074009 12:133259553-133259575 GTTTATAAAGAAAAGAGGTTTGG + Intergenic
1105893701 13:24700307-24700329 ATTTCTAGGGAAAAAAGGGAGGG - Intronic
1106099165 13:26679536-26679558 CTTTCTGATGAGATGAGGGTAGG - Intronic
1107194108 13:37626858-37626880 ATTTATAAAGAAAAGAGGTTTGG - Intergenic
1107640738 13:42440791-42440813 CTCTTTAAGGAAAAGAGGCCGGG + Intergenic
1108900715 13:55404309-55404331 CTATCTATGGCAAATAGGGTGGG + Intergenic
1111757838 13:92421397-92421419 ATTTATAAAGAAAAGAGGTTTGG + Intronic
1112121134 13:96412434-96412456 TTTTGTAAAGAAAAGAGGATGGG + Intronic
1112314788 13:98351310-98351332 ATTTATAAAGAAAAGAGGTTTGG + Intronic
1112965582 13:105188340-105188362 CTTTCTAAGGAAAACATTTTTGG - Intergenic
1113405247 13:110032896-110032918 CTCTTTAAGGAGAAGCGGGTGGG - Intergenic
1116532312 14:45988122-45988144 CTTTCTATGGAGCATAGGGTTGG - Intergenic
1117503495 14:56377261-56377283 CTTTATAAGGGAAAGAAGGAAGG - Intergenic
1118633396 14:67726191-67726213 CTTCCTAAAGAAAAGATAGTGGG - Intronic
1119263232 14:73250504-73250526 CTTTCTAGGGAGCAGAAGGTCGG - Intronic
1119523430 14:75303089-75303111 TCCTCAAAGGAAAAGAGGGTAGG - Intergenic
1119939232 14:78623275-78623297 CTTTCTACTGAAAAGAGAGAAGG - Intronic
1119983429 14:79108288-79108310 CATTCTAAGCAAAAGAGAATTGG - Intronic
1120434267 14:84460517-84460539 CTATCTCAGGCAAATAGGGTTGG - Intergenic
1121147790 14:91600463-91600485 ATTTATAAAGAAAAGAGGTTTGG + Intronic
1121523400 14:94601664-94601686 CTTTCTAAGGCAGAAGGGGTGGG - Intronic
1122518659 14:102326966-102326988 TTTTATAAAGAAAAGAGGGTTGG + Intronic
1123897697 15:24844904-24844926 ATTTCTAAGGAAAATACTGTAGG - Intronic
1124946335 15:34270500-34270522 ATTTATAAAGAAAAGAGGTTTGG + Intronic
1125433298 15:39619893-39619915 GTCTCTAGGGAAAAAAGGGTAGG + Intronic
1125652321 15:41327492-41327514 CTTTAAAAAGAAAAGAGGCTGGG + Intronic
1127763388 15:62163645-62163667 CATTCCAAGGAAAAATGGGTTGG - Exonic
1128985447 15:72217234-72217256 CTTTGTCAGGACAAGAGGGAAGG + Intronic
1129675675 15:77631633-77631655 CATTCTAAGGCAGAGCGGGTGGG - Intronic
1130397273 15:83513561-83513583 CTTTCTAAAGGAAGGAGGGCAGG - Intronic
1130562821 15:84971941-84971963 ATTTATAAAGAAAAGAGGGCTGG - Intergenic
1131481904 15:92789362-92789384 ATTTATAAAGAAAAGAGGTTTGG - Intronic
1133254983 16:4511268-4511290 TTTTTTGAGGGAAAGAGGGTGGG - Exonic
1133656613 16:7871023-7871045 CGTCCTAAGGAGAAGAGAGTTGG - Intergenic
1134809668 16:17156829-17156851 CTTTTTAATGTAAAGAAGGTAGG + Intronic
1135650679 16:24203801-24203823 CTTTCTAAGGAAGTGAGGCTTGG + Intronic
1137589067 16:49682373-49682395 CCTGCTCAGGAAAGGAGGGTGGG + Intronic
1137892581 16:52178145-52178167 CTTTATAAGGACAAGAAGGGAGG + Intergenic
1138670957 16:58614241-58614263 CTTTCTAAGGACAGCAGGCTCGG - Intronic
1139199418 16:64957519-64957541 ATTTCTAAGGAAAGCAGTGTAGG - Intronic
1139965379 16:70742334-70742356 CTTCCTTAGGAAGGGAGGGTCGG - Intronic
1140638869 16:76948731-76948753 ATTTATAAAGAAAAGAGGGCTGG + Intergenic
1140716986 16:77735517-77735539 GTTTATAAAGAAAAGAGGTTTGG - Intronic
1142109728 16:88324878-88324900 ATTTATAAAGAAAAGAGGGTTGG + Intergenic
1142296735 16:89228555-89228577 CTTTCTAATGTAAAGAATGTGGG + Exonic
1142894785 17:2967055-2967077 CTTTCTAAGGAAGAGAATCTGGG - Intronic
1144097919 17:11918525-11918547 CCTTTTAAAGAAAAGAGGGCTGG - Intronic
1144789644 17:17850243-17850265 CTTTGTAAAGAACAGAGGGAGGG + Intronic
1147182575 17:38695909-38695931 CCGTCTAAAAAAAAGAGGGTGGG + Intergenic
1147750855 17:42732335-42732357 TTTTTAAAGGAAAAGAGGCTGGG + Intronic
1148198389 17:45731172-45731194 ATTTATAAAGAAAAGAGGTTTGG + Intergenic
1149744162 17:59078236-59078258 CTTTCTAAGGATAAGAGGTGGGG - Intronic
1150188515 17:63212726-63212748 CTTTTAAAAGCAAAGAGGGTCGG - Intronic
1150454926 17:65299685-65299707 CTTTATAAGAAAAGGAGGTTGGG + Intergenic
1150498037 17:65624137-65624159 ATTTATAAAGAAAAGAGGGTGGG - Intronic
1150680424 17:67280055-67280077 CTTTCCAGGGAAAAGGGGGAGGG - Intergenic
1150958440 17:69888171-69888193 CTATCCCAGGAAAAGTGGGTAGG - Intergenic
1152013171 17:77733252-77733274 CTTTCTGGGGAAAAGATGGTGGG - Intergenic
1152208097 17:78987112-78987134 ATTTCAAAGGAAAAAATGGTGGG + Intergenic
1152732415 17:81978758-81978780 CTTTTTATGGAGAAGAGGGGCGG + Intronic
1154349167 18:13568646-13568668 CTTGCTAAGGAAGAAAGGGAAGG + Intronic
1154960500 18:21303653-21303675 CTTTGTAAGGACAATAGGGCCGG - Intronic
1155656137 18:28195188-28195210 CTATTTAAGGAAAAGTGGGAAGG - Intergenic
1155938043 18:31774736-31774758 CTTTCTAAGAGAAAGAGAGCTGG - Intergenic
1157188044 18:45557483-45557505 CTTCCTAAGGAAAAGGTGTTTGG + Intronic
1157404579 18:47412264-47412286 CTGCCTCTGGAAAAGAGGGTGGG - Intergenic
1157948151 18:52004405-52004427 ATTTCTAATTAAAAGAAGGTGGG + Intergenic
1158401435 18:57125030-57125052 TTTTTTAAAGAAAAGAGGGCAGG - Intergenic
1158953382 18:62518244-62518266 ATTTCAAAGAAAAAGAGGTTGGG - Intergenic
1159172834 18:64795165-64795187 CTTTCTAAGATGAAGAGAGTCGG - Intergenic
1159353971 18:67312805-67312827 CTATTTAGGGAAAACAGGGTAGG + Intergenic
1159577717 18:70200275-70200297 CTTTCTAAGGAAATAAGGAGAGG + Intronic
1160340107 18:78082458-78082480 CCTTCAGAGGAAAGGAGGGTGGG + Intergenic
1162882705 19:13671957-13671979 CCTTTTAAGAAAAAGAGGCTGGG + Intergenic
1162989626 19:14293777-14293799 CATCCTAAGGGAGAGAGGGTAGG - Intergenic
1162997756 19:14347143-14347165 CTTTTGAAGGCAAAGAGGGTAGG + Intergenic
1163214267 19:15864209-15864231 GCATCTAAGGAAAAGAGAGTGGG - Intergenic
1163470242 19:17492444-17492466 CTTTTTAAGAAATAGAGGATGGG + Intronic
1164526442 19:29016844-29016866 TTTCCTAAGGGAAACAGGGTTGG + Intergenic
1165007716 19:32820073-32820095 CTATCGAAGGAGAAGAGGGTGGG + Intronic
1166138419 19:40791571-40791593 GTTGCCAGGGAAAAGAGGGTAGG - Intronic
925820142 2:7792186-7792208 CTTTTTTGGGAACAGAGGGTTGG + Intergenic
926781808 2:16479880-16479902 CTTTATAAGTAAAAGAGGAGTGG - Intergenic
927635827 2:24815910-24815932 GTTTCAAAAGAAAAGAGGGTGGG - Intronic
927642650 2:24855195-24855217 CTTCCTAAGAAGAAGGGGGTGGG - Intronic
927797296 2:26061411-26061433 CTCTCAAAGGAAAACAGGGCTGG - Intronic
928314869 2:30237197-30237219 TTTTCTAAGGAACTGAGAGTGGG + Intronic
928512324 2:32012924-32012946 GTTTCTATGGAAAAGAGGTGTGG + Intronic
929456592 2:42070601-42070623 GTCTTTAAGGAAAAGAGGGAGGG - Intergenic
929590134 2:43140171-43140193 CTTTGTAAGGAAACCTGGGTGGG - Intergenic
929616472 2:43313546-43313568 CTTTCCAAGGGAAAAAGGGCAGG + Intronic
930036471 2:47088569-47088591 CTCTCTAAGACAAAGAGGCTTGG + Intronic
930653648 2:53986923-53986945 ATTTATAAAGAAAAGAGGTTTGG - Intronic
930830222 2:55734746-55734768 GTTTCTAATGAAAGAAGGGTGGG + Intergenic
931389269 2:61826622-61826644 CTTTCAAAGGAAAAATGAGTTGG + Intronic
932032213 2:68201242-68201264 TTTTTAAAGGAAAATAGGGTGGG - Intronic
933069592 2:77840394-77840416 CGTTGTAATGAAAAGAGGGCTGG - Intergenic
933376949 2:81491896-81491918 CTTTTTAATAAAAGGAGGGTTGG - Intergenic
934551591 2:95266152-95266174 ATTTATAAAGAAAAGAGGCTGGG - Intergenic
935314461 2:101817677-101817699 CTTTCCATGGAGAAGAGGGCGGG + Intronic
935321566 2:101894651-101894673 TTATTTAAGGAAAAAAGGGTGGG - Intronic
935600540 2:104917629-104917651 CTTTGTAAGGAAGTGAGGGAAGG + Intergenic
937246346 2:120496569-120496591 CTACCTAAGGATAAGAGGGAAGG + Intergenic
937253224 2:120537139-120537161 CTTCCCAAGGAATAGAGGGGTGG + Intergenic
937298057 2:120821649-120821671 CTTTCTAATAAACAGAGGGGAGG + Intronic
939093958 2:137811125-137811147 CTTTCTAAGGATAAGCGGTCAGG + Intergenic
939434539 2:142156971-142156993 ATGTCTAGGGAAAAGAGTGTTGG + Intergenic
939871600 2:147532395-147532417 AATTTTAAGGAAAAGAGAGTGGG - Intergenic
940866308 2:158820813-158820835 CTTTATAAGGAGAAGAAGGGAGG + Intronic
942707604 2:178794229-178794251 CTTTCTGAGCAAAAGGTGGTCGG - Intronic
942924994 2:181420900-181420922 CTTTCTGAGGAACAGAGGGTTGG - Intergenic
943797850 2:192020135-192020157 AATACTAGGGAAAAGAGGGTAGG - Intronic
944913735 2:204336162-204336184 CTTTCCAAATAAATGAGGGTGGG - Intergenic
947727988 2:232411668-232411690 CTTTGGGAGGAAAAGAGGTTAGG + Intergenic
948039228 2:234886248-234886270 CTATTTAATGAAAAGAGGGCTGG - Intergenic
1169246442 20:4028683-4028705 ATGTCTAAGGAAAAGAGCTTGGG - Intergenic
1169284721 20:4298408-4298430 AGTTCTAAGGACAAAAGGGTGGG - Intergenic
1171403567 20:24894466-24894488 TTTAGTAAGGAACAGAGGGTGGG - Intergenic
1177319497 21:19501703-19501725 CTTTCTAAGAAAAGGTTGGTAGG - Intergenic
1177441479 21:21132280-21132302 TCTTATAAGGAAAAGAGGGTGGG - Intronic
1178505930 21:33162958-33162980 CTCTTCAAGGAAGAGAGGGTGGG + Intergenic
1179014224 21:37581482-37581504 CTTTGTAAGGAGAGGAGGTTAGG + Intergenic
1181912337 22:26248768-26248790 CTTTCCAAGGAAAATGGAGTTGG - Intronic
1182234503 22:28864806-28864828 CTTTCTAAAGAAAATAGTGAAGG - Intergenic
950297027 3:11840883-11840905 CTTTGTAATGAAAAGAGCATTGG - Intronic
950397649 3:12746191-12746213 ATTTATAAAGAAAAGAGGCTGGG - Intronic
951568461 3:24037195-24037217 ATTTATAAAGAAAAGAGGGCTGG + Intergenic
952195351 3:31069436-31069458 CTTACTTGAGAAAAGAGGGTGGG - Intergenic
952582473 3:34850962-34850984 TTTTTTAATGAAAAGATGGTTGG + Intergenic
953404897 3:42655169-42655191 ATTTCCAAGGGAAAGAGGGGAGG + Intronic
955741323 3:62094247-62094269 CTTTGGAAGAAAAAGGGGGTAGG - Intronic
956714367 3:72065230-72065252 CATTCAAAGGAAAAGAGAGAGGG + Intergenic
959699134 3:109281982-109282004 ATTTCTAAAGAAATGAGGTTAGG + Intergenic
959832699 3:110883432-110883454 CTTCCAAAGGAAAATAGGGTGGG - Intergenic
959846472 3:111039649-111039671 ATTTATAAGGAAAAGAGGCTGGG - Intergenic
960417946 3:117408302-117408324 CTTTTTAAAGTAAAGAGGTTAGG + Intergenic
964207450 3:154190102-154190124 CTTTCCAAGGCAAGGAGGGTAGG - Intronic
964427822 3:156571674-156571696 CTTTCCAAGGAGAATATGGTGGG - Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
966871524 3:184292951-184292973 ATTTTTACAGAAAAGAGGGTGGG + Exonic
968257165 3:197286333-197286355 TTTTCCACAGAAAAGAGGGTGGG + Intronic
969101387 4:4771409-4771431 CTTTGAAAGGAGAAGAGTGTGGG + Intergenic
969325514 4:6441716-6441738 CTTGATAAGGAATAGAGGGGTGG + Intronic
970111446 4:12642007-12642029 ATTTCTAAAGGAAAGAGGTTTGG - Intergenic
970821872 4:20226177-20226199 CTTTATAAGGGAAAGAAGGAGGG + Intergenic
971082369 4:23228305-23228327 CTTTTTAAAGAAAAGAGGGTTGG + Intergenic
971297150 4:25405992-25406014 CTTTCTAAAGAAAGGAAGGAAGG + Intronic
971626878 4:28932533-28932555 CTTTCAGAGGTAAAGAGTGTTGG - Intergenic
971972420 4:33636434-33636456 ATTTATAAAGAAAAGAGGTTTGG - Intergenic
974084453 4:57244575-57244597 CTTTCTAAAAAAAAAAGGGGGGG - Intergenic
974287335 4:59885865-59885887 CTTGCTAGGGAAAGCAGGGTAGG - Intergenic
975243982 4:72096620-72096642 ATTTCTAAAGAAAAGAGGCTTGG - Intronic
976967158 4:91057197-91057219 CTGTCTCAGGAATGGAGGGTGGG + Intronic
977575484 4:98669605-98669627 GTTTCTAAGGAAAATCGTGTGGG - Intergenic
978210338 4:106127995-106128017 TTTTCTAAGGAATACTGGGTGGG - Intronic
978323357 4:107522960-107522982 CTGGCTAAGGAAAAGAGGAGTGG - Intergenic
979308133 4:119172354-119172376 CTTTTTAAGGAAAATTTGGTGGG + Intronic
979976594 4:127204293-127204315 GTTTCTAATGAAAAGATTGTGGG + Intergenic
980447473 4:132929272-132929294 CATTCTGAGGAACTGAGGGTAGG + Intergenic
980643091 4:135604441-135604463 TTTTATAAGAAAATGAGGGTGGG + Intergenic
980784252 4:137531967-137531989 ATTTATGAGGAACAGAGGGTTGG - Exonic
982179041 4:152732970-152732992 ATTTATAAAGAAAAGAGGTTTGG - Intronic
984185403 4:176537412-176537434 GTTTCTAAATAATAGAGGGTTGG - Intergenic
987524792 5:19033292-19033314 CTTTCTAATGAAAGGATGATTGG + Intergenic
989416149 5:41178769-41178791 CAGTCTAAGGAAATGAGGCTGGG - Intronic
989652753 5:43711626-43711648 CATTCAAAGGCAAAGTGGGTGGG + Intergenic
990596279 5:57315336-57315358 CTTTTTAAGGAAAGGAAGGCAGG - Intergenic
990884882 5:60580033-60580055 CTTTGGGAGGAGAAGAGGGTAGG - Intergenic
992846888 5:80759339-80759361 CTTTCAGAGGAAGAGAGGGTAGG + Intronic
993543650 5:89184068-89184090 CATTCTAGGGAAAAGAGCTTGGG - Intergenic
993573216 5:89568574-89568596 TTTTCTAAGGAAAAAGAGGTCGG - Intergenic
994249625 5:97520660-97520682 ATTTCTAATGAAAACGGGGTGGG - Intergenic
994763238 5:103883628-103883650 ATTCCTAAGGAAAAGATGTTGGG + Intergenic
995222713 5:109668902-109668924 CTATCTAAGGAACAGGGGGAAGG - Intergenic
996154231 5:120078136-120078158 CCTTCTGAGGAATAGAGGGAAGG - Intergenic
997161537 5:131614342-131614364 ATTTATAAAGAAAAGAGGTTTGG + Intronic
997192194 5:131947552-131947574 CTTTCTAAAGAACAGATGGTAGG + Intronic
997303416 5:132822796-132822818 CTATGTAAGGAGAAGAGGGAAGG + Exonic
997387831 5:133487634-133487656 CTCTCTCAGTAAAGGAGGGTTGG + Intronic
997515618 5:134487236-134487258 ATTTATTAAGAAAAGAGGGTCGG - Intergenic
998344013 5:141444912-141444934 CTTTATCAGGGAAAGAGGGAAGG + Intronic
999322952 5:150626042-150626064 CTTTCTAATGGACAGGGGGTAGG - Intronic
1000005943 5:157185058-157185080 CTTTCTAAATTAAAGATGGTAGG + Intronic
1000070105 5:157732441-157732463 CTGTCTCAGAAAAAGAGGGAGGG + Intronic
1001015215 5:168134791-168134813 CTTTGTTTGGAAAAGTGGGTGGG - Intronic
1001279926 5:170379363-170379385 CTATCTAAGGAAACCAGGGAGGG + Intronic
1002296788 5:178235842-178235864 CTTGCTAAGCAGAAGAGGCTCGG - Intergenic
1002706300 5:181162672-181162694 CATTCTGAGGGAAAGAGGGTTGG - Intergenic
1003581257 6:7342966-7342988 TTTTTTAATGAAAAAAGGGTTGG - Intronic
1004145113 6:13058690-13058712 TTTCCTAAGGAAGAGAGGTTTGG + Intronic
1005081016 6:21956659-21956681 CTTTCTGAGGAATAGAGGAGAGG + Intergenic
1006082251 6:31574371-31574393 CTATCTAAGGAATGGAGGGAGGG + Intergenic
1007483250 6:42163645-42163667 CCCTCCAAGGAAGAGAGGGTGGG + Intronic
1007940968 6:45781168-45781190 ATTTCTAAGGAAAATAAGGAGGG + Intergenic
1009822306 6:68818715-68818737 CTATCTAAGGATAAGAAGCTTGG - Intronic
1009909576 6:69909190-69909212 CTTTCTAAGGAAAAGAGGGTAGG + Intronic
1009911937 6:69940859-69940881 CATTTTAAGGAATGGAGGGTGGG + Intronic
1010339518 6:74731990-74732012 CTTCCTAAGGAAAAAAGATTTGG + Intergenic
1010366042 6:75052205-75052227 TTTTCTATGAAAAAGAGGCTTGG + Intergenic
1010785175 6:79992428-79992450 ATTTGTAAAGAAAAGAGGGCCGG - Intergenic
1010833900 6:80563434-80563456 CTTTCATGGGTAAAGAGGGTGGG - Intergenic
1014188422 6:118462546-118462568 CTTTCTAAGCAAACAAGTGTTGG + Exonic
1015381231 6:132571693-132571715 CTTTGTAAAGAAAAGAGGAAAGG - Intergenic
1015589905 6:134813039-134813061 TTTTGTAAAGAAAAGAGGGCTGG - Intergenic
1016543538 6:145194913-145194935 ATTTATAAAGAAAAGAGGTTTGG + Intergenic
1016591835 6:145754569-145754591 CTGGCTATGGCAAAGAGGGTAGG - Intergenic
1016840984 6:148525272-148525294 TTCTCTGTGGAAAAGAGGGTAGG - Exonic
1017056770 6:150443714-150443736 CTTCCTAATGAAAAGAGGAGAGG + Intergenic
1017552189 6:155520971-155520993 GATTCTAAGCAAAAGAGTGTTGG + Intergenic
1017773245 6:157659685-157659707 CTTTCCAAGGCGCAGAGGGTGGG - Intronic
1018925970 6:168207292-168207314 CTTTCTAAGGAAGGGAGAGGGGG + Intergenic
1019198202 6:170294649-170294671 CTTTCTTTGGAAAGGGGGGTTGG - Intergenic
1020225939 7:6280011-6280033 TTTTCTAAGTAAAGGAGAGTTGG - Intergenic
1020463651 7:8451955-8451977 ATTTTTAAGGAAAAGAGTTTGGG - Intronic
1020622679 7:10536667-10536689 CTATATAAGGAAACGAGAGTAGG - Intergenic
1020838378 7:13183372-13183394 CTTTCTAAAGAAGGGAGGGTGGG - Intergenic
1021638890 7:22719043-22719065 CTAGCTAAGGAACAGAGGGAAGG + Intergenic
1022802320 7:33788258-33788280 CTTCCGAAGGCAAAGAGGGTGGG - Intergenic
1023025372 7:36045115-36045137 GTTTGGAAGGAAAAGAGGATTGG + Intergenic
1024569338 7:50710875-50710897 CTTACTACGGAACAGAGGGCCGG + Intronic
1025218929 7:57088046-57088068 CTTTCAAAGCAGAAGTGGGTAGG + Intergenic
1025629836 7:63261134-63261156 CTTTCAAAGCAGAAGTGGGTAGG + Intergenic
1025652441 7:63482893-63482915 CTTTCAAAGCAGAAGTGGGTAGG - Intergenic
1025911335 7:65831289-65831311 CTTTATAAAAGAAAGAGGGTAGG + Intergenic
1025978288 7:66386906-66386928 CTTTATAAAAGAAAGAGGGTAGG - Intronic
1026463959 7:70637901-70637923 ATTTCTAAAGAAAGGAGGGGAGG - Intronic
1027203873 7:76081594-76081616 CTTTATAAAAGAAAGAGGGTAGG - Intergenic
1027220610 7:76211450-76211472 CTGTCTACGGAAAAAAGGCTAGG - Intronic
1027865548 7:83641206-83641228 TTTTCAAAGGAAAAGATGATGGG - Intronic
1028519860 7:91717785-91717807 CTTTTTAAGGAATTGTGGGTGGG - Intronic
1029192886 7:98784376-98784398 CATGGTCAGGAAAAGAGGGTTGG - Intergenic
1030303268 7:107995308-107995330 CTCTCAAAGGAAAAAAGGGAGGG + Intronic
1031414175 7:121476121-121476143 TTTTTAAAGGAAAAGAGGGGTGG - Intergenic
1031475068 7:122211348-122211370 CTTCCTGAGGAAGAGATGGTAGG + Intergenic
1031672529 7:124567425-124567447 CTCCCTAAGGAAAATATGGTTGG + Intergenic
1031677629 7:124631166-124631188 CTTTCTAAGGAGGAGAAGCTTGG - Intergenic
1032007440 7:128314260-128314282 ATTTATAAAGAAAAGAGGCTTGG - Intronic
1032355070 7:131203474-131203496 ACTTCTCAGGAAAGGAGGGTTGG + Intronic
1035494845 7:159315771-159315793 GTTTATAAAGAAAAGAGGTTTGG + Intergenic
1037719312 8:21429391-21429413 CTTTCTAGGGGAGAGAGGGCAGG + Intergenic
1038863790 8:31416256-31416278 TTATCTAGGGAAGAGAGGGTTGG + Intergenic
1039462173 8:37754262-37754284 CTTTCTAGGGAAAGGAGGGTGGG + Exonic
1039750087 8:40470603-40470625 CTTTATAAGAAAAAGAGATTAGG + Intergenic
1042419219 8:68565472-68565494 GTTTCCAAGGAAGAGAGGGAAGG + Intronic
1042443307 8:68852900-68852922 CTTTGTGAGGAAACGAGGGGTGG + Intergenic
1043171397 8:76971730-76971752 CTTTGTAAGGAAAAGACATTGGG + Intergenic
1043310595 8:78854406-78854428 CCTTCTAAGAAAACGAGGGTTGG + Intergenic
1043655771 8:82663166-82663188 CTATCTCAGGAAAGGAGGCTGGG + Intergenic
1044005276 8:86930873-86930895 CTTTGTAAGGAAAAGCGGTGGGG + Intronic
1046490009 8:114939650-114939672 CTTTAAAAGGAAAAGAGGTTGGG + Intergenic
1047235086 8:123034023-123034045 CTGTCAAAGGAAGAAAGGGTTGG + Intronic
1047940217 8:129822156-129822178 CTTTATAAGGTAAAGAAGTTCGG - Intergenic
1049489803 8:142889796-142889818 ATTTATAAAGAAAAGAGGTTTGG + Intronic
1050372825 9:4939419-4939441 CACTCTAAGGAAAATAGAGTTGG + Intergenic
1050419799 9:5451610-5451632 CTTTCTCAGTAAAAGTAGGTAGG + Intronic
1050485148 9:6126426-6126448 ATTTATAAAGAAAAGAGGTTTGG + Intergenic
1051019562 9:12525796-12525818 CTTTCTAAGGGAAAGGGGGAAGG + Intergenic
1051907641 9:22114993-22115015 ATTTCTAAGGAAAAGACAGAAGG - Intergenic
1052029231 9:23609694-23609716 CTTTATAATGAAAAAAGGGAAGG + Intergenic
1052399910 9:27987321-27987343 CTGTCTCAGGAAAGGAGGGAAGG - Intronic
1053221642 9:36317778-36317800 CTTCCTGAGGAAAAGACGTTTGG - Intergenic
1055454573 9:76460252-76460274 CTTTCTGCAGAAAAGAGAGTCGG + Intronic
1055476587 9:76669008-76669030 CTTTATGAGGAAAAGAGATTAGG - Intronic
1055998685 9:82191029-82191051 ATTTATAAAGAAAAGAGGTTTGG - Intergenic
1056203987 9:84302869-84302891 GTCTCTAAGGAAAAGAGGTAGGG + Intronic
1057907872 9:98996236-98996258 CTTTCTAAGCTAAAGGGGCTGGG - Intronic
1058396881 9:104564404-104564426 CTTTCTTAAAAAAAGGGGGTTGG + Intergenic
1058555598 9:106163459-106163481 CTTTTTAAGTAGAAGAGGGAGGG + Intergenic
1059213101 9:112533265-112533287 ATTTATAAAGAAAAGAGGTTTGG + Intronic
1059733988 9:117083655-117083677 CATTCTAAGGAAAGGCGGGTGGG + Intronic
1059743964 9:117182155-117182177 CTTCCTGAGGAAAAGAGAGCAGG + Intronic
1060354166 9:122888543-122888565 CTTTCTAAGTAAGAGAAGGAGGG - Intronic
1060816049 9:126635836-126635858 CTCTCAAAGGAAAGGAGGGGAGG + Intronic
1062304947 9:135900395-135900417 CACTCTAAGAAAAAGAGGGCCGG + Intronic
1186514818 X:10159002-10159024 CTTTCAAAGCAAAAGCGGGCTGG + Intronic
1186711945 X:12207291-12207313 CTATCTAAAGAAAAGAGCATTGG - Intronic
1187771613 X:22704880-22704902 CTTTCTAAGAAAAGGCGTGTGGG + Intergenic
1188174802 X:26976021-26976043 CTTTCTCAGGAAAAGAAAATGGG + Intergenic
1189766628 X:44378713-44378735 CTTTCTAAGGATAAGCAGTTAGG + Intergenic
1190153516 X:47967992-47968014 GTTTATAAAGAAAAGAGGTTTGG - Intronic
1190524229 X:51311695-51311717 ATTTATAAAGAAAAGAGGGGAGG - Intergenic
1191865266 X:65698642-65698664 CTTCCTGTGCAAAAGAGGGTGGG + Intronic
1192180173 X:68911311-68911333 CTTTGTAAGCAAGACAGGGTGGG + Intergenic
1193271389 X:79533665-79533687 ATTTATAAAGAAAAGAGGTTTGG + Intergenic
1194407348 X:93513296-93513318 GTTTCTAGGGAAATGATGGTGGG - Intergenic
1197513561 X:127398657-127398679 TTTGATAAGGAAAAGTGGGTGGG - Intergenic
1198110070 X:133495146-133495168 CTTCACAAGGAAAAGAGGGTAGG - Intergenic
1198504581 X:137289093-137289115 CTCTCTAAACAAAAAAGGGTGGG - Intergenic
1199925433 X:152458132-152458154 TTCTGTAAGGAAATGAGGGTTGG - Intergenic
1201711865 Y:17001113-17001135 TTTTCTAAGGAAAAAGGGGTTGG + Intergenic