ID: 1009910057

View in Genome Browser
Species Human (GRCh38)
Location 6:69914741-69914763
Sequence GCTGGTTGAAGAATTACCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009910057 Original CRISPR GCTGGTTGAAGAATTACCTC CGG Intronic
900653443 1:3742735-3742757 GCTGGTTGAAGATGTAGCACAGG - Intergenic
901544131 1:9943088-9943110 ACTGGGTGAAGAATCAGCTCCGG + Intronic
903630629 1:24766966-24766988 ACTGGAAGAAGAATTACCTTGGG + Intronic
919127873 1:193418016-193418038 AATGGTTGAAGAAGTCCCTCAGG - Intergenic
921680984 1:218030707-218030729 TCTCTTTGAACAATTACCTCAGG - Intergenic
924010184 1:239656175-239656197 AAGGGTTGAAAAATTACCTCTGG + Intronic
1065292338 10:24243385-24243407 GAGGGTTGAAAAATTACCTATGG - Intronic
1066665228 10:37776382-37776404 GCAGGAGGAAGAATTACTTCAGG + Intergenic
1068797569 10:61101066-61101088 GATGGTTGAATAATTTCCTGAGG + Intergenic
1071971516 10:90912540-90912562 CCTGGTTTAAGAACTACCTATGG + Exonic
1072923366 10:99595429-99595451 GCTGGTTAAAGAATCAAATCCGG - Intergenic
1074602642 10:114931030-114931052 GCAAAGTGAAGAATTACCTCTGG - Intergenic
1077268279 11:1662982-1663004 GCTGGTTGAAGATTTCTCACAGG + Intergenic
1077272602 11:1688637-1688659 GCTGGTTGAAGATTTCTCACAGG - Intergenic
1081581004 11:44351833-44351855 GATGGTGGAACAAATACCTCTGG + Intergenic
1083589902 11:63887680-63887702 GCTGGTTGCAGCCTTGCCTCTGG - Intronic
1087444757 11:98236660-98236682 GCATGTTGATGAATTACTTCTGG - Intergenic
1092345380 12:7710266-7710288 GCTTGTTAAAGCATTACCACTGG + Intergenic
1094391153 12:29951648-29951670 GCTCATTGAAGAATTACTTCAGG - Intergenic
1094788322 12:33877656-33877678 GCTGGTTAATGAATAAACTCTGG - Intergenic
1095705028 12:45227852-45227874 GGTGGTTGAAGAATTGCATGTGG + Intronic
1104310440 12:127649950-127649972 ACTGGTTGAAGTATGGCCTCTGG - Intergenic
1107610985 13:42112780-42112802 GCTGGTGGAAGAACTACAGCGGG - Intronic
1108746692 13:53403006-53403028 GTTGGTTGGAGAATCACCTAGGG + Intergenic
1111893244 13:94108953-94108975 GCTGGTTGAAGAATAACAGGTGG - Intronic
1114934215 14:27513555-27513577 GAGGGTTGAAAAATTACCTGTGG + Intergenic
1116370995 14:44132330-44132352 ACTGATTGAAAAATTAGCTCAGG - Intergenic
1118726122 14:68630272-68630294 GTTGCTTGAAGAAATTCCTCCGG - Intronic
1121761439 14:96448396-96448418 TCAGGTGGAAGAATCACCTCAGG + Intronic
1124836446 15:33199981-33200003 ACTGGTTGAACTATGACCTCTGG - Intergenic
1128034995 15:64517072-64517094 GCTGATTTTAAAATTACCTCTGG + Intronic
1129544944 15:76385869-76385891 GCTGCTGGAATAATTACCACAGG + Intronic
1130983448 15:88828765-88828787 GCAGGTGGGAGAATTAACTCTGG - Intronic
1132410920 15:101577838-101577860 GCTGGATTAAAAATTAGCTCTGG - Intergenic
1135661551 16:24301394-24301416 GGAGGTTGAAGAATTAACTCTGG + Intronic
1137973830 16:53013098-53013120 GAGGGTTGAAAAATTACCTGTGG + Intergenic
1138851290 16:60632880-60632902 GCTGGTTACAGAATTATCTGGGG + Intergenic
1143560018 17:7688208-7688230 GGTGCTTTAAGAATTACCGCGGG + Exonic
1148638512 17:49167578-49167600 GAGGGTTGAAAAATTACCTGTGG - Intronic
1151262957 17:72931033-72931055 GCTCCTTGAAGAATTCTCTCAGG - Intronic
1159919887 18:74218152-74218174 CCTGGTTGAAGGAATACATCAGG - Intergenic
1164116395 19:22223372-22223394 TCAGGTTGAAGAATTTCTTCAGG - Intergenic
1164738353 19:30558999-30559021 GCTGGTTGAAACATTTCTTCCGG + Intronic
1165533561 19:36423989-36424011 GCTGGTTACAGAATTTCCTGGGG + Intergenic
925673965 2:6340373-6340395 GCTGGAAGAAGAATTGCCTTGGG - Intergenic
925736838 2:6971183-6971205 GCTGGTTGGACAGTAACCTCTGG + Intronic
926447903 2:12967296-12967318 GCTGGTTAAAGAATAACATGGGG - Intergenic
927500729 2:23581381-23581403 GCTGGTTGAGGATGAACCTCTGG + Intronic
928743153 2:34379510-34379532 GTTGGCTGAAGAATTTCATCTGG + Intergenic
928783138 2:34848934-34848956 TCTGCTTCAAGAATTACCACAGG - Intergenic
930686224 2:54311513-54311535 GCTGGTTTCAGAATTATCTGGGG + Intergenic
937103974 2:119293536-119293558 GCTGGGTGAAGAATTGCAGCGGG + Intergenic
946354811 2:219178090-219178112 TCTGGTTGACGAAGTACCCCGGG - Exonic
946634992 2:221714981-221715003 GCTGGTTGAAGAATAGTCTATGG - Intergenic
946745384 2:222840130-222840152 GCTGGATGCAGAGTGACCTCTGG - Intergenic
947955655 2:234188317-234188339 GCTGGTGGAAGCATTAACTTGGG + Intergenic
1169043565 20:2517469-2517491 GCCTGCTGAAGAATTCCCTCTGG + Intronic
1169591387 20:7146874-7146896 GATGAATGAAGAATTTCCTCTGG + Intergenic
1170935995 20:20810188-20810210 ACTGGTTGAAGTACTGCCTCTGG - Intergenic
1174168501 20:48601485-48601507 GCTGGTTGAAGCATAGACTCTGG + Intergenic
1177004303 21:15652577-15652599 GCTGGTTTAAGAAATAAGTCAGG - Intergenic
1180102706 21:45596780-45596802 GCTGGCTGGAGAGTTACCTGGGG + Intergenic
1185146654 22:49140858-49140880 ATTGTTTGAAGAAATACCTCGGG + Intergenic
954638405 3:52084105-52084127 GCTGGTTCCAGAATAAACTCTGG + Intronic
957137170 3:76304055-76304077 TGTGGCTGAAGAATTAACTCTGG - Intronic
958638198 3:96772540-96772562 GGGGGTTGAAGAATTACCTTTGG - Intergenic
962046118 3:131760959-131760981 GCTGGATAAAGAATTCCCTGAGG + Intronic
963512147 3:146259886-146259908 GCTGGTTGAACAATTACAGAAGG - Intergenic
963886489 3:150588478-150588500 AATGGTTGAAGCATTTCCTCTGG - Intronic
965138664 3:164807345-164807367 GTGGGTTGAAGAACTACCTGTGG + Intergenic
967903875 3:194485967-194485989 TCTGGTGGAAGTATGACCTCTGG - Intronic
971050468 4:22855892-22855914 TTTGCTTTAAGAATTACCTCAGG - Intergenic
974322864 4:60375002-60375024 GAGGGTTGAAAAATTACCTATGG + Intergenic
982033560 4:151324933-151324955 CCTGGTTGATGACTTATCTCTGG - Intronic
983380330 4:166982953-166982975 ACTCATTGAACAATTACCTCAGG - Intronic
983519772 4:168695974-168695996 ACTGGAAGAAGAATTACCTGGGG + Intronic
987691745 5:21275747-21275769 GCTGGATATAGAATGACCTCAGG - Intergenic
987858825 5:23457164-23457186 TCTGAGAGAAGAATTACCTCTGG + Intergenic
989988830 5:50736807-50736829 TTTGGATGAAGAATTACCTTTGG - Intronic
991748634 5:69774391-69774413 GCTGGATATAGAATGACCTCAGG + Intergenic
991800215 5:70354216-70354238 GCTGGATATAGAATGACCTCAGG + Intergenic
991828385 5:70655825-70655847 GCTGGATATAGAATGACCTCAGG - Intergenic
991892570 5:71353643-71353665 GCTGGATATAGAATGACCTCAGG + Intergenic
995507214 5:112872918-112872940 GCTGGATATAGAATTACCTTTGG + Intronic
995604872 5:113842756-113842778 GCTGGTTGATGAACTAGCCCAGG + Intergenic
1000140221 5:158396162-158396184 GCTGGATGAAGAGTTGCATCTGG + Intergenic
1000450841 5:161384856-161384878 GTTGGGGGAAGAATTGCCTCTGG + Intronic
1002187350 5:177460498-177460520 GCTGCTTGAAGAACTCCCTTGGG + Exonic
1005702829 6:28419902-28419924 GCTGGTTGAGGACTGACCACTGG + Intergenic
1009910057 6:69914741-69914763 GCTGGTTGAAGAATTACCTCCGG + Intronic
1010130341 6:72485395-72485417 GCACGTTTGAGAATTACCTCAGG - Intergenic
1017980607 6:159398096-159398118 TCTTGTTGAAGATTTAACTCTGG + Intergenic
1019946167 7:4331040-4331062 GCTGGTGGAAATATAACCTCAGG - Intergenic
1026553066 7:71384328-71384350 TCTGGTGGCAGAATTTCCTCTGG + Intronic
1033402623 7:141041166-141041188 GCTAGTGGAATAATGACCTCAGG + Intergenic
1034910786 7:154996860-154996882 GCAGGTTTAAGAACTACTTCTGG + Intronic
1038902444 8:31858677-31858699 CCTGGCTGAACAATTACATCTGG + Intronic
1042478649 8:69279219-69279241 TCTTGTTGAAGGATTACCTATGG - Intergenic
1045109966 8:98931046-98931068 GCTGGTTCCAGAATTGCCTGTGG + Intronic
1045250091 8:100475733-100475755 GCAGGCTGAAGAGTTACCTAAGG + Intergenic
1046479864 8:114801379-114801401 GCTGATTGATTAATTACCTAGGG - Intergenic
1048268189 8:133005771-133005793 GCTGGTTAGAGAATAACATCAGG - Intronic
1049913198 9:290336-290358 ACTGGAAGAAGAATTATCTCAGG - Intronic
1055930103 9:81551448-81551470 GCAGGTTGAAAGAATACCTCTGG + Intergenic
1058194130 9:101953267-101953289 ACTGGAAGAAGAATTCCCTCAGG + Intergenic
1059625343 9:116058697-116058719 GCTGGTTGTTGGATTTCCTCTGG - Intergenic
1186843540 X:13508857-13508879 GCAGGTAGTGGAATTACCTCCGG - Intergenic
1187036141 X:15542071-15542093 GCTGCTTGCTGAATTACCTGAGG + Exonic
1188356412 X:29197333-29197355 TCTGTTTGGAGAATTATCTCAGG + Intronic
1188929558 X:36089688-36089710 GTTGTTAGAAGAATTACATCAGG + Intronic
1192634401 X:72804166-72804188 GCAGTCTGTAGAATTACCTCAGG + Intronic
1192647309 X:72916635-72916657 GCAGTCTGTAGAATTACCTCAGG - Intronic
1194126747 X:90027874-90027896 GTTCTGTGAAGAATTACCTCAGG + Intergenic
1194559101 X:95398022-95398044 TCTGATTGAAGAATTCCCTTTGG - Intergenic
1194832589 X:98642669-98642691 GCGGGTTGAAAAAGTACCTATGG - Intergenic
1194890306 X:99371066-99371088 GCTTCTTGAAGACTCACCTCAGG + Intergenic
1195134314 X:101888782-101888804 GTTGGAAGAAGAATTACCTTGGG - Intronic
1199113711 X:143964572-143964594 GCTGGTTACAGAATTTTCTCAGG + Intergenic
1200365104 X:155654443-155654465 GAGGGTTGAAAAATTACCTAAGG - Intronic