ID: 1009910121

View in Genome Browser
Species Human (GRCh38)
Location 6:69915786-69915808
Sequence CCTAATGAAAAGTAATACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009910121_1009910123 -7 Left 1009910121 6:69915786-69915808 CCAATGTATTACTTTTCATTAGG No data
Right 1009910123 6:69915802-69915824 CATTAGGAAAATAAATACAGAGG 0: 1
1: 0
2: 7
3: 46
4: 541

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009910121 Original CRISPR CCTAATGAAAAGTAATACAT TGG (reversed) Intronic