ID: 1009910121

View in Genome Browser
Species Human (GRCh38)
Location 6:69915786-69915808
Sequence CCTAATGAAAAGTAATACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 250}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009910121_1009910123 -7 Left 1009910121 6:69915786-69915808 CCAATGTATTACTTTTCATTAGG 0: 1
1: 0
2: 1
3: 19
4: 250
Right 1009910123 6:69915802-69915824 CATTAGGAAAATAAATACAGAGG 0: 1
1: 0
2: 7
3: 46
4: 541

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009910121 Original CRISPR CCTAATGAAAAGTAATACAT TGG (reversed) Intronic
902161657 1:14535358-14535380 CATAATGCAAAGAAATACACTGG + Intergenic
903606599 1:24579432-24579454 CCTATTTAAGAGTAAGACATAGG + Intronic
904221065 1:28969383-28969405 TTTAAAGAAAAGTAAGACATGGG - Intronic
904436665 1:30503086-30503108 CCTGAGGAAAAGTGATACAAGGG - Intergenic
908799600 1:67865648-67865670 CCTAATGGAAAGTAAAAGCTGGG + Intergenic
910545443 1:88410844-88410866 CCTAATTAAACATAATACAGTGG + Intergenic
910730398 1:90389397-90389419 AATAATAAAAAGTAATCCATAGG - Intergenic
912641305 1:111348307-111348329 CCTAGTGATACGTAATATATAGG - Intronic
913080321 1:115378848-115378870 CCTAGTTACAAGTAAAACATTGG + Intergenic
913938811 1:125084476-125084498 CATCATCAAAAGTAATACAATGG - Intergenic
916671354 1:167024063-167024085 CATAAGGTAAAGTACTACATGGG + Intergenic
916702334 1:167310401-167310423 ACTTATGAAAAGAAATAGATAGG - Intronic
918277848 1:182971029-182971051 CCTATTGAAAAGTATATCATAGG - Intergenic
919244809 1:194968769-194968791 ACAAATGAATATTAATACATTGG - Intergenic
919609459 1:199727151-199727173 CTTAGTGAATAGAAATACATTGG - Intergenic
920905003 1:210155539-210155561 CATAATGAAAAGAAATCCAGGGG + Intronic
921648183 1:217644220-217644242 ACTAATGAAATATAAAACATAGG + Intronic
921843370 1:219853099-219853121 CATAATGGTAAGTAATGCATGGG + Intronic
921950688 1:220926895-220926917 ACTAATTAAATGTCATACATGGG + Intergenic
923594882 1:235353421-235353443 AAAAATGAAAAGTAATAAATAGG - Intergenic
923953861 1:238992657-238992679 CCTTATGCAATGTAAGACATTGG + Intergenic
923953877 1:238992764-238992786 CCTTATGCAATGTAAGACATTGG + Intergenic
923986076 1:239384078-239384100 CCTGAGGAAAAATAATCCATGGG + Intergenic
1063987084 10:11516226-11516248 CCTTATGTAAAATAATACATTGG + Intronic
1066768885 10:38827675-38827697 TCGAATGAAATGTAATACAGTGG + Intergenic
1066968022 10:42287879-42287901 CATTATGAAAAGTAATATAGAGG - Intergenic
1067756646 10:49010658-49010680 CCTAATGAGAAGTAATCCCGAGG - Intergenic
1069010376 10:63365181-63365203 GCTAAGGAAAAGTGATACAGAGG - Intronic
1070686724 10:78490310-78490332 CCAAATGAGAAGACATACATAGG - Intergenic
1071675493 10:87651907-87651929 CCTAATGAAAAGTTCTCCATTGG + Intergenic
1073165742 10:101448827-101448849 CTTAAAGAAAAGTAATATATAGG - Intronic
1074022010 10:109593985-109594007 CCTAGTGAAAAGGAATGAATTGG - Intergenic
1074752593 10:116601050-116601072 CCTAATGAGAAGAGATAGATGGG - Exonic
1075186387 10:120262750-120262772 CCTAATAAAAAGTTATCTATGGG - Intergenic
1077766826 11:5166805-5166827 CCCAATTAAAAGTAATAGAATGG - Intronic
1079967469 11:26995981-26996003 CCAAATGAGAAAGAATACATTGG - Exonic
1080723034 11:34868334-34868356 CCCAATGTAGAGTTATACATAGG + Intronic
1084999496 11:73017277-73017299 CCTATCCAAAAGTAATACGTTGG - Intronic
1088181537 11:107118236-107118258 CATAATGAAAATCATTACATGGG - Intergenic
1088573417 11:111245560-111245582 CCTAATGGAAATTCATTCATGGG + Intergenic
1091276305 11:134353992-134354014 CCCAATCAAAAGACATACATTGG - Intronic
1091483262 12:856602-856624 CACAATGAAAAGTAATATATTGG - Intronic
1092312403 12:7372268-7372290 AAGAATGAAAACTAATACATAGG + Intronic
1093245651 12:16732884-16732906 CCTATTGAAAAGTGATACATAGG + Intergenic
1093748337 12:22769072-22769094 CCACATGAAAAGTATAACATAGG + Intergenic
1094042078 12:26128866-26128888 ACTAATGAAAGGAAATACTTAGG + Intronic
1094097228 12:26720232-26720254 CCAAATGAAATGCAATAAATAGG - Intronic
1094387044 12:29906454-29906476 CCTACTGAAAATTCATACAATGG + Intergenic
1094431828 12:30378456-30378478 CCACATGCAAAGAAATACATAGG - Intergenic
1094522104 12:31202424-31202446 CCTAATGACATGTAACACACTGG - Intergenic
1094608248 12:31968421-31968443 CCTAATGTAAACTTATAGATGGG - Intronic
1095760903 12:45834737-45834759 CTCAATGAAAAGAAATACGTTGG + Intronic
1096221476 12:49831232-49831254 CTAAATGAAAAGTAAAATATTGG - Intergenic
1098695827 12:73553767-73553789 CCAAATAAAATGTAATACACTGG - Intergenic
1099511837 12:83548331-83548353 CCTAATGAAAAGACACAGATTGG - Intergenic
1100702441 12:97162783-97162805 ACACATGAAAAGTAAGACATAGG - Intergenic
1101523107 12:105503188-105503210 CCTAAGGAAAAGTGAGATATAGG + Intergenic
1101711667 12:107273059-107273081 TCTAATGCCAAGTTATACATGGG + Intergenic
1104358536 12:128110845-128110867 CCAATTGAAAAATAATACATGGG - Intergenic
1105653106 13:22402438-22402460 CCTAAAGAAAAATAATACCTTGG - Intergenic
1105933304 13:25072848-25072870 TCAAATGAAATGTATTACATAGG + Intergenic
1109592258 13:64501036-64501058 CATAATAAAAAGTGATACACAGG + Intergenic
1111735731 13:92137172-92137194 TCTACTGAATAATAATACATGGG - Intronic
1111902404 13:94215676-94215698 TGTAATGAAATGTAATAAATTGG - Intronic
1112492153 13:99876887-99876909 CCTCAAGAAAAGACATACATTGG - Intronic
1112520076 13:100087429-100087451 CCTAAGGAAAACTAATCCAAAGG + Intergenic
1113033295 13:106018094-106018116 CTTTATGAAAAGTTATCCATTGG + Intergenic
1115850952 14:37589614-37589636 GATAAAGAAAAGTGATACATTGG + Intergenic
1115868633 14:37776273-37776295 CCCAATGAAAAGGCATACAGTGG - Intronic
1116998030 14:51344780-51344802 CCCAAGGAAAACTATTACATAGG + Intergenic
1118947526 14:70401440-70401462 CTTAATTAAAAGTAATATTTAGG + Intronic
1119572273 14:75685629-75685651 CCTAATGATAAGAATTACCTAGG + Intronic
1120071317 14:80106829-80106851 TCTAATGAAAAGCAAGACGTGGG + Intergenic
1121070048 14:91010684-91010706 TATAATGAAAAGGAATACAGGGG + Intronic
1124086240 15:26552858-26552880 CCAAATGAACAGGAACACATTGG - Intronic
1124875379 15:33587153-33587175 AATAATAAAAAGAAATACATGGG + Intronic
1125077700 15:35638851-35638873 CTTAATGAGAAGAAATAAATTGG - Intergenic
1125270694 15:37935594-37935616 ACTAATGTAAATTAATTCATTGG - Intronic
1128630875 15:69265569-69265591 TCTTAGGAAAATTAATACATTGG + Intronic
1130267919 15:82425506-82425528 CATAATGAAAACTAAAAAATTGG + Intergenic
1130504106 15:84521328-84521350 CATAATGAAAACTAAAAAATTGG - Intergenic
1132167385 15:99608596-99608618 CATGATAAAAAGTAATACTTTGG + Intronic
1132413533 15:101604114-101604136 CCTCATGAAAAGCAATGCTTGGG - Intergenic
1134208501 16:12256932-12256954 CCAAAAGAAAACTAATACAGTGG - Intronic
1134345837 16:13390810-13390832 GCTGATGAAAAGAAATACTTAGG + Intergenic
1134389190 16:13803387-13803409 CTTAATGATAAGTGATAAATAGG + Intergenic
1135893177 16:26375146-26375168 GCAAATGAAAAGTAACCCATTGG + Intergenic
1136741434 16:32532942-32532964 CCTAATGAAAAGGAATGTTTAGG + Intergenic
1137027263 16:35489298-35489320 TCTAATGATAATTAATACACGGG - Intergenic
1138168659 16:54828078-54828100 CCTAAGGGAAATTAAAACATTGG - Intergenic
1138869302 16:60862057-60862079 CCTAAAGAAAAATAAAATATAGG - Intergenic
1140528266 16:75642031-75642053 CCTATTCAAAACTAATGCATAGG - Intronic
1141786834 16:86206565-86206587 CCTTTTAAAAAGAAATACATGGG + Intergenic
1203028169 16_KI270728v1_random:542292-542314 CCTAATGAAAAGGAATGTTTAGG - Intergenic
1203043552 16_KI270728v1_random:792139-792161 CCTAATGAAAAGGAATGTTTAGG + Intergenic
1145947737 17:28790189-28790211 ACTAATGTAAACAAATACATTGG + Intronic
1146252442 17:31360359-31360381 TTTAATGATAAGTAATACAAAGG + Intronic
1203199265 17_KI270729v1_random:260708-260730 TCAAATGAAATGTAATACAACGG + Intergenic
1203208865 17_KI270730v1_random:61448-61470 TCAAATGAAATGTAATACAACGG + Intergenic
1154100252 18:11466388-11466410 CTTATTGTAAAGTAATAAATTGG + Intergenic
1155963772 18:32017685-32017707 CCTAATTAAAAGTAAAGCCTGGG + Intergenic
1156833277 18:41521752-41521774 CTTAAAGAAAAATAAGACATTGG - Intergenic
1157383703 18:47245974-47245996 CCAACTGAAAAGTACTACCTGGG - Intronic
1158211327 18:55053757-55053779 CCTAAGAAAAAGTGATACAGAGG + Intergenic
1158799281 18:60887419-60887441 GCTAATGAAGAGAACTACATGGG + Intergenic
1158847180 18:61456899-61456921 CCTAATGAAAGGAGATACAAGGG - Intronic
1159159414 18:64623879-64623901 CCTTATCAAAGGTCATACATAGG + Intergenic
1159530028 18:69643916-69643938 CCAAATTAAAAATAATACAATGG - Intronic
1163728860 19:18938544-18938566 CCTAATACAAGGTAATACCTGGG - Intronic
927308478 2:21600808-21600830 CCTAATGAAAATAAATTTATAGG + Intergenic
928937614 2:36695816-36695838 TCTAATGCCAAGTTATACATGGG - Intergenic
929277137 2:40038220-40038242 CCCAATGAATAGTAAAATATAGG + Intergenic
929375034 2:41275192-41275214 CCTAATGTAAATTAGTTCATAGG + Intergenic
930669405 2:54132670-54132692 TCAATTGAAAAATAATACATTGG - Intronic
930735910 2:54778544-54778566 CACAATAAAAAGAAATACATGGG - Intronic
931685775 2:64791447-64791469 CATAATGAACAGAAATTCATTGG + Intergenic
932183876 2:69674582-69674604 CCTAATGTATAGAAATACAATGG + Intronic
932186632 2:69702311-69702333 CATAATAAAAAGTAAAAAATAGG - Intronic
932223903 2:70023821-70023843 GCAATTGAAAAGTAATACAGTGG - Intergenic
932390629 2:71387870-71387892 CCTTAAGAAAATTAACACATAGG - Intronic
933108051 2:78358291-78358313 CCTTCTGAAAAATAGTACATAGG + Intergenic
933643013 2:84784363-84784385 CCTCATGAAAATAAATACATGGG + Intronic
936023209 2:109011178-109011200 GCTAATAAAAAGGAAAACATGGG - Intergenic
938027251 2:127960612-127960634 CTTAAGGAAAATTAATATATTGG - Intronic
938419002 2:131128666-131128688 CCAAATGAAAAGTGAATCATTGG + Intronic
940389960 2:153120928-153120950 CCTAATCATAACTAATACTTTGG - Intergenic
940507596 2:154576794-154576816 TCTAATAAAAAATAATAAATAGG - Intergenic
940550788 2:155153220-155153242 CTAAATGAAAAGGAATATATTGG + Intergenic
940764047 2:157770513-157770535 CCCTATGAAAAGCAAAACATAGG + Exonic
944758874 2:202792502-202792524 CTTAATAAAAAGTAATAAACTGG + Intronic
945138895 2:206662365-206662387 CCTAATGAGAAATAAGACAATGG + Intronic
947220516 2:227787510-227787532 CCTGAGGAGAAGTAATAAATAGG - Intergenic
947397392 2:229699912-229699934 TCAAATGAAAAATGATACATAGG + Intronic
947495970 2:230637369-230637391 TGTAATAAAAAATAATACATTGG + Intergenic
947833354 2:233157709-233157731 CATAATGAAAACTGAAACATCGG + Intronic
947984890 2:234439563-234439585 TCAAATGAAAAGTGATAAATTGG + Intergenic
1170050816 20:12143433-12143455 CCCAATTAAAAGGAATACAGTGG - Intergenic
1176368393 21:6047446-6047468 CCTAATAAAAAGTCAAAAATTGG + Intergenic
1176527758 21:7933767-7933789 CGGAATGGAATGTAATACATTGG - Intergenic
1177848841 21:26322764-26322786 CCTCCTGGAAAGTAATAAATAGG - Intergenic
1179755126 21:43491096-43491118 CCTAATAAAAAGTCAAAAATTGG - Intergenic
1180676704 22:17591444-17591466 CCTACGGAAAAATAAAACATGGG + Intergenic
1181915228 22:26274529-26274551 CCTAATAATAAGTAAAAAATAGG - Intronic
1183637571 22:39073850-39073872 AGTAAAGAAAAGAAATACATTGG + Intronic
950914785 3:16633358-16633380 CCTAAAGAAAAGTGATAAAGAGG + Intronic
950973024 3:17208727-17208749 CATAAAGAAAAGTAATTAATTGG + Intronic
951954996 3:28243716-28243738 CCTAGGGAACAGTAGTACATAGG + Intronic
953600488 3:44359071-44359093 CTTAATTAAAAAAAATACATTGG - Intronic
954740150 3:52743106-52743128 CCTAATTAAAAATATTTCATAGG - Intronic
956287076 3:67621892-67621914 AATAATTAAATGTAATACATAGG - Intronic
957239641 3:77642020-77642042 ACTTATTAAAATTAATACATCGG + Intronic
957525836 3:81377887-81377909 CCTAATGATAATTAAAACCTAGG + Intergenic
958076955 3:88692474-88692496 CCTAATGAAAAGACATAGAATGG + Intergenic
958534716 3:95385574-95385596 CCCAATGAAAACTTATACAGTGG - Intergenic
959515166 3:107257893-107257915 TATAATGAAAAGTCACACATCGG - Intergenic
959823259 3:110762415-110762437 TATAATGAAAAGTAATTTATTGG + Intergenic
960487809 3:118274498-118274520 TCTAATAAAAAGAAAAACATGGG - Intergenic
961699950 3:128735621-128735643 TTTAATGAAAAGTTAAACATGGG + Intronic
962002546 3:131313617-131313639 TCTTCTGAAAAGTAAGACATAGG + Intronic
963848974 3:150189336-150189358 CCTAATAAAAGGAAATACTTAGG - Intergenic
963871058 3:150414021-150414043 CCTAATGCAAAGTTCTATATTGG + Intronic
964086448 3:152824614-152824636 CATAATGAAAAATAAAAAATAGG - Intergenic
964517330 3:157526580-157526602 ACTTATGAAAAGTAATAGCTTGG - Intronic
964989939 3:162797511-162797533 GCTAATGAAAATTAATAGACAGG - Intergenic
965003763 3:162989560-162989582 CCTAATAAAAAGCGATACTTAGG - Intergenic
966112779 3:176423525-176423547 CCAAAAAAAAAGTACTACATAGG + Intergenic
966457182 3:180130590-180130612 CAGAAAGAAAATTAATACATAGG + Intergenic
967677896 3:192322224-192322246 ACAAATGAAATGTAATACCTAGG + Intronic
969128956 4:4976824-4976846 CCTCATGAAATTAAATACATTGG - Intergenic
969982006 4:11167419-11167441 GCTAATTAAAAGTACTCCATGGG + Intergenic
970979929 4:22084329-22084351 CCTAAAGTAAATTAATACAGTGG - Intergenic
971056914 4:22923368-22923390 GCTAATGGAAACTAAGACATGGG - Intergenic
972061618 4:34881403-34881425 CCTAATGAAAAGCAGTACTGAGG - Intergenic
973031890 4:45354196-45354218 TCTAATGGAAAGGAAAACATAGG + Intergenic
976310956 4:83612828-83612850 CCTAATCAAAAGATATACACTGG - Intergenic
976885107 4:89972626-89972648 TGTAATGAAAAGCAATATATAGG - Intergenic
978595936 4:110377351-110377373 CCTAAGAAAAACTTATACATTGG + Intronic
980849722 4:138366159-138366181 CCAAAAGAAAACTAATACATTGG + Intergenic
982571094 4:157051419-157051441 ATTAATGTAATGTAATACATAGG + Intergenic
983022621 4:162698007-162698029 CCTAATTAAAAGTTATAAAATGG - Intergenic
983722891 4:170879711-170879733 CAAAATGAAATGTAACACATGGG + Intergenic
983835990 4:172385708-172385730 TCCAATGAAAAGGAAGACATTGG - Intronic
983846797 4:172530715-172530737 TCTAAGGAAAAGTGATACAATGG + Intronic
990636214 5:57730736-57730758 CCTAATGAAGATAAAGACATAGG + Intergenic
990932157 5:61104729-61104751 CTTACTGTAAATTAATACATGGG - Intronic
993443886 5:87988833-87988855 CCTAGTGAAAGGGAATGCATTGG + Intergenic
995094114 5:108214669-108214691 CCTGATCAAAATTAATAAATCGG - Intronic
995953485 5:117745862-117745884 CTTAATGAAAAGTTGTACACAGG + Intergenic
996519132 5:124407126-124407148 CCTAATCAAAAGAAATCTATTGG - Intergenic
997816636 5:137025723-137025745 CTGAATGAAAAGTGATACAAAGG + Intronic
998045082 5:138980557-138980579 CCTCATGAAAAGTGACACAGTGG - Intronic
998662306 5:144253266-144253288 CTAAATGAAAAGTGATACATGGG - Intronic
999429045 5:151510398-151510420 CCTAAAGAACAGTAATAAACAGG + Intronic
1000682171 5:164198785-164198807 ACTAATGAAAAGTATTATTTGGG - Intergenic
1003356058 6:5371574-5371596 TCTAGTGAACAGTAATAAATTGG + Intronic
1005113234 6:22308663-22308685 CCAAATGAAAAGTCATTCATGGG - Intergenic
1007624807 6:43239175-43239197 AACAATGAAAAATAATACATTGG + Intergenic
1009910121 6:69915786-69915808 CCTAATGAAAAGTAATACATTGG - Intronic
1010005289 6:70989227-70989249 CCTAATGATAATAAATACACAGG + Intergenic
1010078845 6:71833131-71833153 CCTAATATAAACTTATACATAGG - Intergenic
1012739324 6:102994438-102994460 CCTGAGGAAATATAATACATAGG - Intergenic
1012868294 6:104644121-104644143 ACTAATGAAAAGAAAAACATGGG - Intergenic
1014024697 6:116631785-116631807 CCTAAAAAAAAGTAACACATAGG + Intronic
1017887735 6:158612731-158612753 ACTAATAAAAAATAACACATGGG - Intronic
1018459556 6:163985027-163985049 CCTAATAAAAATTAATTCAATGG - Intergenic
1018832802 6:167458021-167458043 ACTAATAAAAATTAATAAATTGG + Intergenic
1020041174 7:5002921-5002943 CATAATAAAAAGTAAAAAATAGG - Intronic
1020642115 7:10768371-10768393 CTCAATGTAAATTAATACATTGG + Intergenic
1021029480 7:15713003-15713025 CCAAATGTAAAGTAAGACTTTGG - Intergenic
1021220655 7:17972147-17972169 CCCAATTAAAAGCAATATATCGG + Intergenic
1021584708 7:22195502-22195524 CTTGCTGAAATGTAATACATCGG - Intronic
1023471981 7:40532384-40532406 CCTAATGATAAGCATTAGATAGG + Intronic
1024535731 7:50430670-50430692 CTTTATGAAAAATAAAACATAGG + Intergenic
1024954849 7:54906570-54906592 ACTAAAGAAAAGGAAGACATAGG - Intergenic
1025531269 7:61887532-61887554 CCTAATGAAAAGGAATGCTTAGG + Intergenic
1025839011 7:65126384-65126406 TTTAATGGAAAGTGATACATGGG - Intergenic
1025884055 7:65569581-65569603 TTTAATGGAAAGTGATACATGGG + Intergenic
1025889389 7:65633025-65633047 TTTAATGGAAAGTGATACATGGG - Intergenic
1026274057 7:68861471-68861493 CCTGATGAAAAATAACACAATGG + Intergenic
1026412978 7:70145153-70145175 ACCAATGGAAAGAAATACATAGG - Intronic
1027457176 7:78407337-78407359 CCTAATGGAAAGTTAAACATAGG - Intronic
1027701680 7:81478132-81478154 CCTATTAAAAAGTAATTCAGAGG + Intergenic
1027830655 7:83172979-83173001 TCTTATGAAAAGTAATTTATTGG - Intergenic
1027867714 7:83668898-83668920 TCTAATGAAAAGAAATATATTGG + Intergenic
1028675485 7:93455710-93455732 CATAATGAAATGTATTACAATGG + Intronic
1029863795 7:103603567-103603589 CCTGAGCAAAAGTAAGACATGGG - Intronic
1031853063 7:126888952-126888974 TTTAATGGAAAGTGATACATGGG + Intronic
1033838482 7:145344458-145344480 CCTAATGACAGGTAAAACAGAGG - Intergenic
1034884409 7:154787615-154787637 TCTACTGAAAAGAAATTCATTGG + Intronic
1035482147 7:159195825-159195847 CCAAATGAAAAGTAGGGCATTGG - Intergenic
1037027749 8:14060172-14060194 CCAAATGAAAAACAAAACATAGG - Intergenic
1037993116 8:23334701-23334723 CCAACTGATAAGTAATAGATTGG + Intronic
1039677274 8:39683158-39683180 CATGTTGAAGAGTAATACATGGG + Intronic
1041388980 8:57332309-57332331 CCAAATGAAAATTACTATATGGG + Intergenic
1042957766 8:74270542-74270564 CTTAAAGAAAAGTAACACTTTGG + Intronic
1044405482 8:91820913-91820935 CCTAATTAAAAGACATAGATAGG + Intergenic
1044835989 8:96296437-96296459 CCTTATGAAAAAGAACACATGGG - Intronic
1045030628 8:98132027-98132049 CAAAATGAAAAGTAACTCATTGG - Intronic
1045722081 8:105124285-105124307 TCTAATGAAAGATAATACATAGG + Intronic
1045728645 8:105206651-105206673 CATAAAGAAAAGAAAAACATTGG - Intronic
1046428062 8:114082101-114082123 CTTTATGTAAAGGAATACATAGG + Intergenic
1046568651 8:115934179-115934201 CATAATGAAGAGGAATATATTGG - Intergenic
1049992812 9:1006066-1006088 CAAAATTAAAAGTAATTCATTGG + Intergenic
1050819470 9:9859388-9859410 CCTAATGGAAAATAATGCCTTGG + Intronic
1050899060 9:10921991-10922013 CTTAATGCAAACTAATACAAAGG - Intergenic
1051521674 9:17996264-17996286 CCTTATGATAATTAATACAGCGG - Intergenic
1057591101 9:96374228-96374250 CTTTATAAAAAGTAATTCATTGG + Intronic
1058143956 9:101389526-101389548 CCTAAAGAAAAGTGATAGAAGGG - Exonic
1058874290 9:109229682-109229704 CCTAATCAGAATTAACACATTGG + Intronic
1059720166 9:116952202-116952224 CTTTATGAATAGTAATGCATGGG + Intronic
1062674081 9:137729713-137729735 CAGAAAAAAAAGTAATACATGGG - Intronic
1203389392 Un_KI270438v1:83677-83699 CGGAATGGAATGTAATACATTGG + Intergenic
1187781843 X:22835826-22835848 CCTCAAGAAAATTAAAACATAGG + Intergenic
1188718441 X:33492522-33492544 CCAAATTAAAAGAAATACAATGG + Intergenic
1190506195 X:51128562-51128584 CCCAATGAAAAGGCATACAATGG - Intergenic
1191110725 X:56801572-56801594 TTTCATGAAAAGTAACACATTGG - Intergenic
1191858011 X:65643190-65643212 ACTAATGAAAAATCAGACATTGG - Intronic
1193835465 X:86337744-86337766 CCTAATTAAAAGTCATAGACTGG + Intronic
1194137107 X:90159360-90159382 ACTAATGAAAAGAAGTACATGGG - Intergenic
1195131048 X:101852612-101852634 CCTAATGAATATTGATACAAAGG + Intronic
1195807448 X:108791510-108791532 CCCAATGAAAAGACATAGATTGG - Intergenic
1196924871 X:120623455-120623477 CCTTTTCAAAAGTAAAACATTGG - Intergenic
1197582506 X:128301175-128301197 AATAATGAAAATTAATACCTAGG + Intergenic
1199935977 X:152574049-152574071 CCTAGTGAAATGTAAGTCATGGG - Intergenic
1200276170 X:154735017-154735039 CCTAATTAATAGAAAAACATGGG + Intronic
1200482843 Y:3729283-3729305 ACTAATGAAAAGAAGTACATGGG - Intergenic
1202194005 Y:22276899-22276921 CATAATGAAATGTAATACAGTGG + Intergenic
1202365802 Y:24163268-24163290 CATAATGAAAACTAAAAAATTGG + Intergenic
1202504980 Y:25506854-25506876 CATAATGAAAACTAAAAAATTGG - Intergenic
1202619727 Y:56753193-56753215 CCGAATGGAAAGTAATCCAATGG + Intergenic
1202622653 Y:56829454-56829476 TCTAATGAAATGTAATAGAATGG - Intergenic