ID: 1009910714

View in Genome Browser
Species Human (GRCh38)
Location 6:69923667-69923689
Sequence CTGGAGTCCTACAAATATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009910714_1009910719 22 Left 1009910714 6:69923667-69923689 CCAACATATTTGTAGGACTCCAG 0: 1
1: 0
2: 1
3: 11
4: 103
Right 1009910719 6:69923712-69923734 GCTGTGTGAAAACTCCGGAAAGG 0: 1
1: 0
2: 0
3: 5
4: 103
1009910714_1009910718 17 Left 1009910714 6:69923667-69923689 CCAACATATTTGTAGGACTCCAG 0: 1
1: 0
2: 1
3: 11
4: 103
Right 1009910718 6:69923707-69923729 ACAGGGCTGTGTGAAAACTCCGG 0: 1
1: 1
2: 3
3: 17
4: 203
1009910714_1009910716 -1 Left 1009910714 6:69923667-69923689 CCAACATATTTGTAGGACTCCAG 0: 1
1: 0
2: 1
3: 11
4: 103
Right 1009910716 6:69923689-69923711 GACACATATTTCTATGTTACAGG 0: 1
1: 0
2: 1
3: 13
4: 233
1009910714_1009910717 0 Left 1009910714 6:69923667-69923689 CCAACATATTTGTAGGACTCCAG 0: 1
1: 0
2: 1
3: 11
4: 103
Right 1009910717 6:69923690-69923712 ACACATATTTCTATGTTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009910714 Original CRISPR CTGGAGTCCTACAAATATGT TGG (reversed) Intronic
906476950 1:46175777-46175799 CAGGAGTCCCCCATATATGTAGG + Intronic
908467091 1:64406984-64407006 CTGAAGTCCCACAAATAAGAAGG + Intergenic
913026370 1:114846275-114846297 CAGCAGTCCTACACATACGTGGG + Intergenic
917815321 1:178704091-178704113 TTGGTGTCTTACAAATATATAGG - Intergenic
920969446 1:210730606-210730628 CTGGAGTCTTACTATTTTGTGGG + Intronic
921906675 1:220502585-220502607 CTGGACTCCTATAAGTCTGTAGG + Intergenic
922681688 1:227603549-227603571 CTGTAGTCCTGCTAGTATGTAGG + Intronic
922881779 1:228986448-228986470 CTGGAGACCTGCAAATCTGAGGG + Intergenic
923831268 1:237560169-237560191 CTAGAGTCCCAGGAATATGTTGG + Intronic
1063698485 10:8361093-8361115 CTGCAATCATACAAATGTGTGGG - Intergenic
1066316100 10:34247972-34247994 CGGGAGTCCTACACATTTTTAGG + Intronic
1068268934 10:54694506-54694528 CTGGTGTCCAACAAATCTATCGG + Intronic
1068778712 10:60896437-60896459 ATGGAGTCCTACAGATATTTGGG + Intronic
1070838053 10:79463703-79463725 CTGGAGGCCTGCGAATCTGTAGG - Intergenic
1078119112 11:8488346-8488368 CTAGATTCCTAGGAATATGTTGG - Intronic
1082062605 11:47873511-47873533 CAGAAATCCTACAAGTATGTTGG - Intergenic
1084767140 11:71319851-71319873 CTGGAGTTTTTCAAATTTGTTGG - Intergenic
1088041189 11:105384128-105384150 GTGCAGTCCTACCAATAAGTAGG + Intergenic
1089193930 11:116680201-116680223 CTGGAGGCCTTGAAATATTTGGG - Intergenic
1090153635 11:124412871-124412893 CAGGATCACTACAAATATGTGGG + Intergenic
1094239279 12:28202763-28202785 CTGGAGTTCAAGGAATATGTTGG + Intronic
1096713861 12:53478912-53478934 CTGGAGTTCTATCAATGTGTAGG - Intronic
1097683969 12:62675057-62675079 CTGAAGTGTTAGAAATATGTTGG + Intronic
1101410351 12:104462599-104462621 TTGGAGTCTTACCAATTTGTAGG + Intronic
1104368163 12:128196596-128196618 TTGGAGTCCTGAAAATATTTTGG - Intergenic
1105663926 13:22530960-22530982 CTGGAGCCCTAGTAAAATGTGGG + Intergenic
1105955056 13:25273937-25273959 CTGGAGACCAAAAAATATTTTGG + Intronic
1107563157 13:41575523-41575545 CAAGTGTCCTAAAAATATGTAGG + Intronic
1112249031 13:97761759-97761781 CTACATTCCTAGAAATATGTTGG - Intergenic
1117704958 14:58455887-58455909 CTAGATTCCTAGGAATATGTTGG + Intronic
1120969858 14:90198245-90198267 CTGGAGGCCTCCTATTATGTGGG - Intergenic
1121016071 14:90549864-90549886 CTGAAGGCGTACAAATATGCTGG - Intronic
1122368399 14:101212875-101212897 CTGGATTCCTGGAAAGATGTTGG + Intergenic
1122707601 14:103630723-103630745 TTGTATTCCTACAAATATTTAGG - Intronic
1126106200 15:45148504-45148526 GTGGACTCCTAAAAGTATGTGGG - Intronic
1128194266 15:65736725-65736747 CTGGCCTCCCACAGATATGTAGG - Intronic
1137351167 16:47714904-47714926 CTCGAGTCCTACAAATGGATGGG - Intergenic
1137574164 16:49587435-49587457 CGGGGGTCCAACAAACATGTGGG + Intronic
1140692501 16:77498094-77498116 CAGCAGTCCTACAAATAAGGTGG + Intergenic
1141100829 16:81196356-81196378 CTGGAGTCATCCAAATCTGTTGG + Intergenic
1148556970 17:48584566-48584588 CAGAAGTCCTACAAAGACGTGGG + Intronic
1149416525 17:56465636-56465658 CAGGAGTTTTACAAATATGCAGG - Intronic
1150957413 17:69874479-69874501 CTAGAGTCTCAGAAATATGTTGG - Intergenic
1154943127 18:21133863-21133885 CTGGAGTCCTATAAAGATATTGG + Intergenic
1156523857 18:37747623-37747645 CTGAATTCCTATAAATATCTGGG - Intergenic
1162275465 19:9650516-9650538 ATGGAGACCAACAAATAGGTCGG - Intronic
929606617 2:43239006-43239028 CTGGAGTGCTTCAAATGGGTGGG + Intronic
931514191 2:63033099-63033121 CTGGAGTCCTGCAATAATGTTGG + Intronic
933641776 2:84769860-84769882 CTGGATTCCCAAAAATATGTAGG - Intronic
935505701 2:103899751-103899773 CTGGATTCCATCAAATTTGTAGG - Intergenic
939926824 2:148185175-148185197 AGGCAGTCCTTCAAATATGTGGG - Intronic
943193681 2:184715508-184715530 CTGTAGTCCTAGCTATATGTGGG - Intronic
945542277 2:211103687-211103709 ATGGAGTACTACAAAGCTGTTGG + Intergenic
948579514 2:238974905-238974927 CTGGAGTCCCACAAATGTGTTGG - Intergenic
1175536207 20:59715898-59715920 CTGGTGTGCTACAAACATTTAGG - Intronic
1178427004 21:32486770-32486792 CTAGAATCCTACAAATAACTTGG + Intronic
1182592404 22:31391839-31391861 CTGGAATCCTAGAACTTTGTGGG + Intergenic
1183132317 22:35850481-35850503 CTGGAGGCCTCCAGATATGCAGG + Intronic
953091953 3:39736800-39736822 CTGGAAACCTACAATTATGGTGG - Intergenic
953430327 3:42834495-42834517 CTATAGTCCTACATATTTGTGGG - Intronic
955977690 3:64493796-64493818 CTGGAGTGCTACTGATATCTAGG - Intergenic
956336539 3:68170542-68170564 CTGGATTCCCAGAAATATATTGG - Intronic
956970706 3:74521921-74521943 CTGGACTCCTACAATTCAGTTGG + Intergenic
957528461 3:81408506-81408528 CAGGAGTCTTACACATATTTTGG - Intergenic
958523251 3:95218442-95218464 CTGCAGTTCTACACATATCTGGG + Intergenic
958923003 3:100127119-100127141 TTTGAGTCCCACAAATATGCTGG - Intronic
959606570 3:108248050-108248072 CTTGACTCCTACAAAATTGTGGG + Intergenic
963786804 3:149543028-149543050 ATGGAGTCCTCCTTATATGTCGG - Intronic
966953250 3:184844520-184844542 CTGGATTCCTACTAGGATGTAGG + Intronic
967619271 3:191612646-191612668 CTGGAGTGCAACAAATATAATGG - Intergenic
970885802 4:20986248-20986270 CTTGAGTCCTAGAAATAAGTTGG + Intronic
974157693 4:58095325-58095347 CAGGAGTCTTACAAACATGGAGG + Intergenic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
981667886 4:147250563-147250585 CTGGATTCCAAGAAATATGTTGG - Intergenic
982109167 4:152037808-152037830 CTGAATTGCAACAAATATGTTGG + Intergenic
982502392 4:156173130-156173152 CTGGGGTCCCACAGATCTGTTGG + Intergenic
982603393 4:157482085-157482107 ATGGAGACCTACAAAGACGTAGG + Intergenic
986891590 5:12315308-12315330 CTGGAGTCATTCAAAAATGTTGG - Intergenic
986920693 5:12675930-12675952 CAGCAGTCCTACAAACCTGTTGG - Intergenic
991402626 5:66269979-66270001 CTAGATTACTAGAAATATGTTGG + Intergenic
992810861 5:80387043-80387065 GTGGGGTCCTACAACAATGTTGG + Intergenic
993118861 5:83750571-83750593 CTAGATTCCCAGAAATATGTTGG + Intergenic
995656994 5:114437708-114437730 AGAGAGTCCTACAAAAATGTTGG - Intronic
996877574 5:128256282-128256304 CTAGAGTCCTACAAACCTTTAGG - Intergenic
998070029 5:139190581-139190603 CTAGAGTCCCACTATTATGTGGG + Intronic
1007513533 6:42393174-42393196 CTGAAGTACTACAAAGATGCTGG - Intronic
1007887048 6:45241539-45241561 CTTGAGGCCAATAAATATGTGGG + Intronic
1008134360 6:47756828-47756850 CTGGACTCCTAGAAGTTTGTGGG - Intergenic
1009910714 6:69923667-69923689 CTGGAGTCCTACAAATATGTTGG - Intronic
1013327963 6:109067207-109067229 CTGGAGACCTACAGATAGGGAGG - Intronic
1014973279 6:127845845-127845867 CTGGATTCTTAGGAATATGTTGG - Intronic
1016701082 6:147055000-147055022 CCGGAGTCCTATAAAAATGCTGG + Intergenic
1021928551 7:25556655-25556677 CTGGTGTCCCAGAAATATCTTGG + Intergenic
1022972331 7:35529649-35529671 CTGGTGCCCTAAGAATATGTGGG - Intergenic
1026999634 7:74643529-74643551 CTGAAATCCCACAAGTATGTGGG - Intergenic
1027540988 7:79465081-79465103 CTGTAGTACTTCTAATATGTTGG - Intergenic
1029933224 7:104395741-104395763 CTGGTGTCCTAGAAAAATCTAGG - Intronic
1031449218 7:121893811-121893833 CTGGAACCCTATAAATATTTAGG - Intronic
1031520872 7:122764111-122764133 CTGGAGTGAAACAAGTATGTGGG - Intronic
1035255498 7:157623343-157623365 GTAGAGTTCTACAAATAGGTAGG + Intronic
1037460454 8:19103265-19103287 CAGGAGACTTACAATTATGTTGG + Intergenic
1047758832 8:127939197-127939219 ATGGAGCCCTTAAAATATGTTGG - Intergenic
1048853679 8:138668758-138668780 CTGGAGTGCTTCACATAAGTGGG - Intronic
1050975906 9:11937817-11937839 CTGCAGGCCTACATATATGTGGG - Intergenic
1051387118 9:16521190-16521212 CTGGTCTCTTCCAAATATGTCGG - Intronic
1052103339 9:24478986-24479008 CTGCAGTCTTTCAAATACGTAGG - Intergenic
1053478883 9:38401523-38401545 CTGGAGTCTGAGAAATATGGAGG + Intergenic
1054783477 9:69188055-69188077 CTTGAGTTCTACAAATATTATGG + Intronic
1058601199 9:106672298-106672320 CTGTAGTCTTCCAAATATGTGGG - Intergenic
1185790454 X:2925071-2925093 CTGGCCTCCTCCAAATTTGTAGG - Intronic
1193317626 X:80082145-80082167 TTAGAGTCCTAGAAATATGTTGG + Intergenic
1197359319 X:125479469-125479491 CTCCACTCCTACAAATATTTTGG + Intergenic
1198480883 X:137039223-137039245 TTGGAGTCCCAGAAATAAGTAGG + Intergenic
1199152065 X:144498856-144498878 TTGGATTTCTACAAATATATAGG - Intergenic
1199537866 X:148924033-148924055 CTGAAGTCCTACATATAATTAGG - Intronic
1201283873 Y:12362897-12362919 CTGGCCTCCTCCAAATTTGTAGG + Intergenic