ID: 1009915534

View in Genome Browser
Species Human (GRCh38)
Location 6:69990888-69990910
Sequence CTAAAATAGAAGTCAGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1061
Summary {0: 1, 1: 0, 2: 8, 3: 115, 4: 937}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009915534_1009915542 -2 Left 1009915534 6:69990888-69990910 CCTTTTTCTGACTTCTATTTTAG 0: 1
1: 0
2: 8
3: 115
4: 937
Right 1009915542 6:69990909-69990931 AGGTTTGGGGGGTACATGGCAGG No data
1009915534_1009915541 -6 Left 1009915534 6:69990888-69990910 CCTTTTTCTGACTTCTATTTTAG 0: 1
1: 0
2: 8
3: 115
4: 937
Right 1009915541 6:69990905-69990927 TTTTAGGTTTGGGGGGTACATGG 0: 1
1: 3
2: 9
3: 57
4: 353
1009915534_1009915543 29 Left 1009915534 6:69990888-69990910 CCTTTTTCTGACTTCTATTTTAG 0: 1
1: 0
2: 8
3: 115
4: 937
Right 1009915543 6:69990940-69990962 ATGAGTAAATTGTGTGTCACAGG 0: 8
1: 57
2: 169
3: 421
4: 835
1009915534_1009915544 30 Left 1009915534 6:69990888-69990910 CCTTTTTCTGACTTCTATTTTAG 0: 1
1: 0
2: 8
3: 115
4: 937
Right 1009915544 6:69990941-69990963 TGAGTAAATTGTGTGTCACAGGG 0: 3
1: 25
2: 100
3: 292
4: 735

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009915534 Original CRISPR CTAAAATAGAAGTCAGAAAA AGG (reversed) Intronic
903089872 1:20903911-20903933 CTAAAAGAATAGTCAAAAAAAGG + Intronic
903094156 1:20953653-20953675 TTAAAATAGAAGACAAAAGAAGG - Intronic
905400496 1:37699231-37699253 CTAAAATGAAAGTGAAAAAAGGG + Intronic
905429882 1:37914062-37914084 CTGAAAAAGGAGTCAGCAAAGGG - Intronic
905586134 1:39120201-39120223 ATGAAATAGAAATTAGAAAATGG - Intronic
905671673 1:39794693-39794715 CAAAAAAAAAAGTCAGAAGATGG + Intergenic
905784830 1:40746408-40746430 CTCAAATATATGTCAAAAAAAGG - Intronic
906737418 1:48143953-48143975 CAGAAATAGAATTCAGAATATGG + Intergenic
906836443 1:49087255-49087277 CAGAAATAGAATTCAGAATATGG + Intronic
906926612 1:50124546-50124568 ATAAAATAGGAGACAGAACATGG - Intronic
907232283 1:53010915-53010937 CTGAAAAAGGAGTCAGCAAAAGG - Intronic
907568747 1:55463381-55463403 TTAAAAAAGAAGTAAGAAAGTGG + Intergenic
908306082 1:62818285-62818307 TTAAAATAGAAGTCTGACCATGG - Intronic
908597702 1:65706470-65706492 CTGAAATAGAAGTCCCAAATAGG + Intergenic
908818668 1:68059385-68059407 CACAAATAGAATTCAGAACATGG + Intergenic
908855022 1:68417201-68417223 CTAAAATAAAAGTTAAAAAATGG + Intergenic
909412903 1:75375029-75375051 CTGACATAGAATTCAGAATATGG + Intronic
909437258 1:75656782-75656804 CTAAAATACAAGTAACAAAATGG + Intergenic
909703649 1:78554441-78554463 CAAATATAGAATTCAGAATACGG + Intergenic
909715315 1:78701057-78701079 CAGAAATAGAATTCAGAATATGG - Intergenic
910135711 1:83966639-83966661 TTAGAATAGAAGTAAGGAAATGG + Intronic
910863284 1:91764341-91764363 CTAAAATGAAAGTCTGAAACGGG + Intronic
911588956 1:99724458-99724480 AGAAAATAGCAGTTAGAAAAAGG + Intronic
912033976 1:105287408-105287430 CTAAAATACAAGGCAGAGGAAGG + Intergenic
912100189 1:106193975-106193997 CAGAAATAGAATTCAGAATATGG + Intergenic
912164275 1:107023727-107023749 CTAAAATGGAACTCAACAAAAGG + Intergenic
912585922 1:110765568-110765590 ATAAAAGAGAAGTCACAAGAAGG + Intergenic
912639329 1:111330160-111330182 CAGAAATAGAATTCAGAATATGG - Intergenic
913039814 1:115011417-115011439 CCAAAAAAGGAGTCAGCAAAGGG + Intergenic
913217056 1:116629490-116629512 CAAAAAAAGAAGTCAGAGAGGGG + Intronic
913529423 1:119723044-119723066 CTGAAATAGGAGAAAGAAAAGGG + Intronic
914755174 1:150558273-150558295 CCAATATAGAAGTCAGATAAGGG + Intronic
915243732 1:154541897-154541919 CTAAAGTCGGAGTCAGAACAGGG + Intronic
915377901 1:155413749-155413771 CTGAGATAGAAGGGAGAAAAAGG + Intronic
915815878 1:158963901-158963923 CAGAAATAGAATTCAGAATATGG + Intronic
915872891 1:159580463-159580485 CAAAAGTATAAGACAGAAAATGG + Intergenic
916011510 1:160710514-160710536 CTAGAAAAGAAGTCAGAGAAAGG + Intronic
916200712 1:162268767-162268789 CTAAAAAAGAAGTCAGTAGAAGG + Intronic
916621021 1:166497502-166497524 CTGAAAAAGAATTCAGAAAAAGG + Intergenic
916757704 1:167789273-167789295 TTAAAAAAAAATTCAGAAAATGG - Exonic
916835546 1:168541269-168541291 TTAAAATAGATGGCAGAAGAAGG - Intronic
916839057 1:168580881-168580903 TTAAAATAGATGGCAGAAGAAGG + Intronic
917050917 1:170922120-170922142 CTAGAATACAAGTAACAAAATGG + Intergenic
917149269 1:171927815-171927837 CAGAAATAGAATTCAGAATATGG - Intronic
917258957 1:173147153-173147175 CAAAAATAGAATTCAGAATATGG - Intergenic
917521799 1:175753859-175753881 AAAAAATAGAAGCAAGAAAAAGG - Intergenic
918001871 1:180504916-180504938 CTAAAATGTAAGAAAGAAAAAGG + Intergenic
918509341 1:185293290-185293312 CCAATCTCGAAGTCAGAAAAGGG - Intergenic
918797577 1:188922600-188922622 CTAAAGTAGAAAGCAGAGAAAGG - Intergenic
919247498 1:195007022-195007044 CTAAAATAATATACAGAAAATGG + Intergenic
919335495 1:196225401-196225423 CTAATTTAAGAGTCAGAAAAGGG - Intergenic
919355620 1:196517437-196517459 CAGAAATAGAATTCAGAATATGG + Intronic
919568327 1:199217536-199217558 CAGAAATAGAATTCAGAATATGG - Intergenic
920150948 1:203907182-203907204 CTAAAATATGAGTCAGAAGTAGG + Intergenic
920781766 1:208998962-208998984 ACAAAATAGACCTCAGAAAAAGG + Intergenic
920973110 1:210759338-210759360 CAAACATAGAATTCAGAATATGG + Intronic
921465951 1:215487958-215487980 AGAAAATTCAAGTCAGAAAATGG + Intergenic
921699929 1:218257336-218257358 CTATAATAGAGATCAGAAGAAGG - Intergenic
921800575 1:219398530-219398552 CCAAAATAGAATTCAGAATATGG - Intergenic
922310553 1:224385321-224385343 ATAAAATAAAAGTCAACAAAGGG + Exonic
922384826 1:225072513-225072535 CTGAAGTAGAATTCAGAATATGG - Intronic
922973454 1:229762303-229762325 CAAAAAAAAAAGTGAGAAAAAGG + Intergenic
923801445 1:237213476-237213498 CTAAAATACAAAACAAAAAAAGG - Intronic
923821030 1:237441730-237441752 CTAAACTAGAATCCAGAAGACGG - Intronic
1063127872 10:3151364-3151386 CTAAAAAAGAAACAAGAAAAAGG + Intronic
1063269947 10:4497147-4497169 CTAAAATAAAAGTTAAAAAATGG - Intergenic
1063361306 10:5461530-5461552 ATGAAATAGAAACCAGAAAAAGG + Intergenic
1063457373 10:6193651-6193673 CCAAAAAAGGAGTCAGCAAAGGG + Intronic
1064732625 10:18348426-18348448 CTAAATTTGAACTCAGAAAAAGG + Intronic
1065014903 10:21453456-21453478 CTAATTTAGAGGTCAGTAAAAGG + Intergenic
1065990452 10:31004364-31004386 GTAACACAGAAGACAGAAAATGG + Intronic
1066086938 10:31980329-31980351 CTAAAATAAAAGTTAAAAAAAGG - Intergenic
1066102921 10:32133790-32133812 CTGAAAAAGGAGTCAGCAAAGGG + Intergenic
1066103632 10:32138555-32138577 CCAAAAAAGGAGTCAGCAAAGGG + Intergenic
1066187842 10:33027901-33027923 CTAAAAGTGAAATGAGAAAAGGG - Intergenic
1066249723 10:33621179-33621201 TGAAAAGAGAAGTGAGAAAATGG + Intergenic
1066515172 10:36150993-36151015 CTAAAATATAAGACAGTAATAGG + Intergenic
1067924994 10:50499432-50499454 CTAAAAGTTAAGTCACAAAAAGG + Intronic
1067984746 10:51130214-51130236 CTAACAGAGAAGTTAGAGAATGG + Intronic
1068307772 10:55235943-55235965 CTAACATTCCAGTCAGAAAATGG - Intronic
1068323165 10:55446991-55447013 ATAAAACAGAAGTCATAAAATGG + Intronic
1068462850 10:57350345-57350367 CAGAAATAGAATTCAGAATATGG - Intergenic
1068799487 10:61123471-61123493 TTAAAATACAAAACAGAAAAGGG - Intergenic
1068990297 10:63143232-63143254 CAAAAATAGAAGTGGGGAAAAGG + Intronic
1069158728 10:65063426-65063448 CTAAAATAAAAGTTGAAAAAAGG - Intergenic
1069333963 10:67327201-67327223 CAGAAATAGAATTCAGAATATGG - Intronic
1069805830 10:71124456-71124478 CAGAAATAGAATTCAGAATATGG - Intergenic
1070187142 10:74075452-74075474 CTAAAAGAGATTCCAGAAAAAGG - Intronic
1070495390 10:77016652-77016674 TTAATATAGGAGTCACAAAACGG - Intronic
1070709215 10:78666090-78666112 CTAAAATTTAAGGCAGAAAGAGG - Intergenic
1071039403 10:81287858-81287880 CAATAATAGAATTCAGAATATGG + Intergenic
1071350734 10:84741008-84741030 TTAAAGTAGAAGTCAAAACAGGG - Intergenic
1071366600 10:84906881-84906903 CTTCTATAGAAGTTAGAAAAGGG - Intergenic
1071454816 10:85837827-85837849 CAGAAATAGAATTCAGAATATGG + Intronic
1071611658 10:87037691-87037713 CAGAAATAGAATTCAGAATATGG - Intergenic
1071736321 10:88304360-88304382 CGGAAATAGAATTCAGAATATGG + Intronic
1071755056 10:88528186-88528208 AAAAAAAAGAAGTTAGAAAAGGG + Intronic
1071792521 10:88970384-88970406 GTGAAATGGAAGTCAGAAAAGGG - Intronic
1071877510 10:89857459-89857481 ATAAAGTAGAAGTCAGGATAAGG + Intergenic
1072178966 10:92960742-92960764 TTTAAATAGAACCCAGAAAAAGG - Intronic
1072280356 10:93860433-93860455 CTAAAGTAGAAGGCAGTAAGGGG + Intergenic
1072504843 10:96055356-96055378 CTAAAATAGAACACAGTAATAGG + Intronic
1072879860 10:99215845-99215867 CTATAATAGAAGTCACTGAATGG + Intronic
1073972105 10:109055911-109055933 ATAAAATATAAGTGACAAAAAGG + Intergenic
1074410783 10:113226711-113226733 CAAAAATAAAACTAAGAAAAAGG + Intergenic
1074483105 10:113845895-113845917 CTTAAATATAAGTAGGAAAATGG - Intronic
1074670607 10:115786227-115786249 CTAAAAAAAAAGTCTGCAAATGG - Intronic
1076538275 10:131196936-131196958 CTAAAATGAAAGGCAGAACAAGG + Intronic
1077397295 11:2331333-2331355 CCAAAAAAGGAGTCAGCAAAGGG + Intergenic
1077553132 11:3211918-3211940 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
1077962238 11:7088072-7088094 ATAAAAAACAAGTTAGAAAAGGG + Intergenic
1077984702 11:7340335-7340357 CAGAAATAGAATTCAGAATATGG - Intronic
1078789805 11:14531139-14531161 CTAAAATAAAAGTTGAAAAAAGG - Intronic
1078816194 11:14824307-14824329 CAGAAATAGAATTCAGAATATGG + Intronic
1078870606 11:15340903-15340925 CAGAAATAGAATTCAGAATATGG - Intergenic
1078993387 11:16671312-16671334 CAGAAATAGAATTCAGAATATGG + Intronic
1079524958 11:21375045-21375067 CTAAAATAAAAGTTGAAAAAAGG - Intronic
1079621041 11:22554737-22554759 CTAAAAGAGATGTCAAAACATGG + Intergenic
1079700572 11:23541205-23541227 CTAGAATAGAATTCAGTAAAAGG - Intergenic
1079808800 11:24969000-24969022 CTAAAATATAACTTAAAAAAAGG - Intronic
1079962164 11:26938002-26938024 AGAAAAAAGAAGACAGAAAAAGG - Intergenic
1080236665 11:30077146-30077168 ACAAAATATAAGTTAGAAAATGG + Intergenic
1080256553 11:30296476-30296498 CCAAAATATAATTCAGAATATGG + Intergenic
1080713269 11:34771405-34771427 CAGAAATAGAAGTCACAATATGG - Intergenic
1080822818 11:35823778-35823800 ATAAAAGGGAAGGCAGAAAATGG - Intergenic
1080984683 11:37447299-37447321 CTAAGATTTTAGTCAGAAAATGG - Intergenic
1082110358 11:48267132-48267154 ATATCATAGAAATCAGAAAATGG + Intergenic
1082692519 11:56323726-56323748 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
1083008308 11:59369284-59369306 CAGAAATAGAATTCAGAATATGG + Intergenic
1083701749 11:64483931-64483953 CCAAAAAAGGAGTCAGCAAAGGG + Intergenic
1085569934 11:77550506-77550528 CTGAAAAAGGAGTCAGCAAAGGG - Intronic
1085812860 11:79701138-79701160 CAAAATTAGAATTCAGAATATGG + Intergenic
1085854239 11:80158053-80158075 CTCAAATAGCTGTCAGACAAAGG - Intergenic
1086020512 11:82224005-82224027 TTAAAATAAAAGTTAAAAAAAGG - Intergenic
1086303735 11:85458410-85458432 CAGAAATAGAATTCAGAATATGG - Intronic
1086569014 11:88262042-88262064 CAGAAATAGAATTCAGAATATGG - Intergenic
1086802871 11:91199379-91199401 CTAAAATATAATGCATAAAAGGG - Intergenic
1086814187 11:91348239-91348261 TTAAAATATAAGTCAGATGATGG + Intergenic
1087094893 11:94308648-94308670 ATGAAAAAGAAGTAAGAAAAAGG + Intergenic
1087309839 11:96528500-96528522 CAGAAATAGAATTCAGAATACGG + Intergenic
1087773922 11:102240566-102240588 ACAAAACTGAAGTCAGAAAAGGG + Intergenic
1087863730 11:103197263-103197285 CTGAAATAGAAGGAGGAAAATGG + Intronic
1088213044 11:107477227-107477249 TAAAAATAAAAGTTAGAAAAAGG + Intergenic
1088702332 11:112424559-112424581 CTGAAAGAGAAGTGGGAAAAAGG + Intergenic
1089168561 11:116496931-116496953 CTGAATTTGAAGACAGAAAAAGG + Intergenic
1089355838 11:117852866-117852888 TTAAAAAGGAAGTCAGAAAATGG - Intronic
1089530843 11:119128170-119128192 CTAAAACATAAGTCAGACAAAGG - Intronic
1090111751 11:123918303-123918325 CTAGACTATAAGTCAGAGAAGGG + Intergenic
1090124604 11:124072666-124072688 GGAAAATAGAAGAAAGAAAAAGG - Intergenic
1090162375 11:124509554-124509576 CAGAAATAGAATTCAGAATATGG - Intergenic
1092680527 12:10974811-10974833 CAGAAATAGAATTCAGAATATGG + Intronic
1093022806 12:14218915-14218937 CTAGTATACAAGTCAGTAAATGG - Intergenic
1093060608 12:14599019-14599041 CAGAAATAGAATTCAGAATATGG - Intergenic
1093326028 12:17775042-17775064 CTAAAATAAAAGTTATAAAAAGG - Intergenic
1093507859 12:19889704-19889726 CTAAAAAAAAAGGCAGACAATGG + Intergenic
1093931273 12:24957047-24957069 CTAAAATAAAATTAAGAAGAAGG - Intergenic
1094693716 12:32795722-32795744 CTAAGATGGAAGTGAGGAAAAGG + Intronic
1095173314 12:39060584-39060606 CCAAAAAAGGAGTCAGCAAAGGG - Intergenic
1095298799 12:40558295-40558317 CTAAAGTAAATGTAAGAAAAGGG - Intronic
1095546608 12:43378820-43378842 CTATAATAGCAGTGACAAAATGG + Intronic
1095824195 12:46515047-46515069 CAGAAATAGAATTCAGAATATGG - Intergenic
1095836019 12:46639209-46639231 CAGAAATAGAATTCAGAATATGG + Intergenic
1096887980 12:54736529-54736551 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
1097159023 12:57032678-57032700 CTAAAAAAGAAGAAAAAAAAAGG + Intronic
1097560195 12:61194770-61194792 CCAAGATATAAGTCATAAAAAGG + Intergenic
1098511449 12:71318838-71318860 CTAAAATGGAAACCACAAAAGGG + Intronic
1099024786 12:77451492-77451514 TTAAAATAAAAGTTAAAAAATGG + Intergenic
1099284716 12:80703304-80703326 GAAAAATAGAAGAAAGAAAAGGG - Intergenic
1099396802 12:82150209-82150231 CTAAAATATAAGTAACAACAGGG + Intergenic
1099498138 12:83378156-83378178 CAGAAATAGAATTCAGAATATGG - Intergenic
1099991679 12:89729030-89729052 CTAAAATAAAAGTTAAAAAAAGG + Intergenic
1100045557 12:90376033-90376055 TTAAAATAGAAGTTAAAAAATGG - Intergenic
1100454484 12:94739225-94739247 CTAAAATAAAAGTTAAAAAAAGG - Intergenic
1100462671 12:94816518-94816540 CTAAAATCAAATTCAGAAACTGG + Intergenic
1100640688 12:96479670-96479692 TTAAAATAAAAGTTAAAAAAAGG + Intergenic
1100775874 12:97973882-97973904 CAAACCTAGAAGGCAGAAAAGGG + Intergenic
1100785407 12:98073011-98073033 CTAAAGTAGAAGGTAGAAAGTGG - Intergenic
1101023904 12:100582111-100582133 CTGAAAAAGGAGTCAGCAAAGGG + Intronic
1101110946 12:101485264-101485286 CTAACTCAGAAGTCACAAAATGG + Intronic
1101191153 12:102334066-102334088 CTAAAGTAGTATTCAGAATAAGG - Intergenic
1101616020 12:106338169-106338191 CTAAAATAAAAGTTGAAAAAGGG - Intronic
1102388537 12:112531241-112531263 CCAAAAGAGAACTGAGAAAAGGG - Intergenic
1102412429 12:112731656-112731678 CTAAATTAGAAGTGAGAGGAAGG - Intronic
1102802280 12:115746579-115746601 CTACAATAGAAGTTATTAAAAGG - Intergenic
1103026323 12:117577105-117577127 CCAAGATAGAAGTGAGAGAACGG - Intronic
1105245291 13:18644835-18644857 TAATAAAAGAAGTCAGAAAAGGG - Intergenic
1105251623 13:18703878-18703900 CCAAAAAAGGAGTCAGCAAAGGG - Intergenic
1105389710 13:19963603-19963625 CTAAAATAGACATATGAAAAGGG + Intronic
1105396579 13:20042519-20042541 CAGAAATAGAATTCAGAATATGG - Intronic
1105532672 13:21234083-21234105 GTAAAACAGAAGTCAGAGAAAGG + Intergenic
1106468187 13:30031526-30031548 CTGAAATAGAAGTTAAAAGATGG + Intergenic
1106744203 13:32682309-32682331 CAGAAATAGAAACCAGAAAATGG - Intronic
1107132666 13:36912748-36912770 GTAAAATAGAAGACATAAACAGG - Intronic
1107377159 13:39816437-39816459 CTAAATTCTAACTCAGAAAAAGG + Intergenic
1107655537 13:42589212-42589234 CCAAACTGGAAGTCAGAAGATGG + Intronic
1107776765 13:43852151-43852173 CAGAAATAGAATTCAGAATATGG + Intronic
1108282299 13:48872118-48872140 CTAAAAAAGGAGTCAGCAAAGGG + Intergenic
1108775732 13:53762605-53762627 CCAAAATAGAATTCAGAATATGG + Intergenic
1109245711 13:59952563-59952585 CTAAAACAGAAGGAAAAAAAAGG + Intronic
1109422532 13:62132055-62132077 CTGAAAAAGAGGTCAGCAAAGGG - Intergenic
1109445571 13:62435473-62435495 CTAAAATACAAGCCACAAAATGG - Intergenic
1109913077 13:68942560-68942582 CTGAAAAAGAATTCAGAAACAGG + Intergenic
1109916807 13:68999745-68999767 CAGAAATAGAATTCAGAATATGG - Intergenic
1110268840 13:73570553-73570575 CGATAATACAAGTTAGAAAATGG + Intergenic
1110657893 13:78022284-78022306 AAAACATAGAAGTCAGGAAATGG + Intergenic
1110866901 13:80406695-80406717 CAAAAATAGAATTCAGAATGTGG - Intergenic
1110954345 13:81535214-81535236 CAGAAATAGAATTCAGAATATGG + Intergenic
1111326484 13:86703420-86703442 CTAAAATAAAAGTTAAAAAAAGG + Intergenic
1111360117 13:87164900-87164922 TTAAAATAAAAGTTAAAAAAAGG + Intergenic
1111703683 13:91721687-91721709 CTAAAATAGAAGAGAAAGAAAGG - Intronic
1111776887 13:92674749-92674771 ATAAATTAGAACTTAGAAAAGGG + Intronic
1111811938 13:93102330-93102352 CTAATCTAGTAGTCATAAAATGG - Intergenic
1111818509 13:93185105-93185127 CAAAGAAAGAAGACAGAAAAAGG + Intergenic
1112129486 13:96505790-96505812 TAAAAATAGAACTAAGAAAATGG + Intronic
1112212999 13:97399872-97399894 ATAAAATAGAAATCAGATCACGG + Intergenic
1112359267 13:98702495-98702517 CTTAACCAGAAGCCAGAAAAAGG - Exonic
1112420598 13:99244327-99244349 TTAAAATAGACTTTAGAAAATGG - Intronic
1112809758 13:103204046-103204068 AAAAAATAGAAGTCAGAACCTGG - Intergenic
1112938693 13:104833259-104833281 CAAGAAGAGAAGTGAGAAAATGG + Intergenic
1113227031 13:108169935-108169957 CAGAAATAGAATTCAGAATATGG + Intergenic
1113535532 13:111063311-111063333 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
1114197846 14:20494860-20494882 CCAAAAAAGGAGTCAGCAAAGGG + Intergenic
1114221420 14:20701143-20701165 CCAAAAAAGGAGTCAGCAAAGGG - Intergenic
1114234827 14:20814609-20814631 CTGAAAAAGGAGTCAGCAAAGGG + Intergenic
1114586854 14:23823237-23823259 CAAAATTAGAAGTGACAAAAGGG - Intergenic
1114759896 14:25302154-25302176 CAGAAATAGAATTCAGAATATGG + Intergenic
1115702749 14:35971166-35971188 ATAAAATAGAACTAAGTAAATGG + Intergenic
1115868765 14:37777577-37777599 CAGAAACAGAATTCAGAAAATGG - Intronic
1116104796 14:40488362-40488384 CTAAGATAAAAGTAAGATAAAGG + Intergenic
1116146471 14:41076960-41076982 TTAAATTAAAAGTCAAAAAATGG + Intergenic
1116381809 14:44278478-44278500 CTCAAAAAGAAGACAGTAAATGG - Intergenic
1116557620 14:46332863-46332885 CAAAAAAGGAAATCAGAAAATGG + Intergenic
1116782552 14:49251780-49251802 CAGAAATAGAATTCAGAATATGG + Intergenic
1116959253 14:50953070-50953092 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
1117410703 14:55448304-55448326 CTGAAATAGAAGTGAAAAAAAGG - Intronic
1118448668 14:65876775-65876797 CAGAAATAGAATTCAGAATATGG - Intergenic
1118540234 14:66814825-66814847 CAGAAATAGAATTCAGAATATGG + Intronic
1118718863 14:68579811-68579833 AGAAAATAGAAGAGAGAAAATGG + Intronic
1118957773 14:70498410-70498432 CAGAAATAGAATTCAGAATATGG + Intergenic
1119021063 14:71115670-71115692 CTAAACTACAATACAGAAAATGG + Intergenic
1119139777 14:72255886-72255908 CTAACATAAAAGCCAAAAAATGG - Intronic
1119276215 14:73358683-73358705 CAATAATAGAAGTAAGAAGAAGG - Intronic
1119336257 14:73836215-73836237 CTAAAACAGATCTCATAAAATGG - Intergenic
1119559749 14:75580588-75580610 CTGAAAAAGGAGTCAGCAAAGGG + Intronic
1119819353 14:77601461-77601483 CCAAAAAAGGAGTCAGCAAAGGG - Intronic
1120300892 14:82705327-82705349 CAAGAATAGAATTCAGAATATGG - Intergenic
1120372222 14:83650808-83650830 CCGTTATAGAAGTCAGAAAATGG + Intergenic
1120595977 14:86436755-86436777 ATAATATAGAAGGCATAAAAAGG + Intergenic
1123453524 15:20392016-20392038 CCCAAACAGAAGGCAGAAAAAGG - Intergenic
1123806202 15:23876629-23876651 ATAAAAAAGAAGCCAGAACATGG + Intergenic
1123875614 15:24621265-24621287 CAGAAATAGAATTCAGAACATGG - Intergenic
1124132984 15:27006499-27006521 CTAAAATAAAAGTTGGAAGAGGG - Intronic
1124622520 15:31282364-31282386 ATAAAATAGACTTCAGTAAAAGG - Intergenic
1124814737 15:32978403-32978425 CCAAAATATAAGTCACAAAATGG + Intronic
1124892472 15:33745818-33745840 CTGAAATACAAGTGAGAAAGTGG + Intronic
1124958498 15:34376379-34376401 CCAAAAAAGTAGTCAGCAAAGGG - Intergenic
1125009913 15:34860341-34860363 CTTAAATAGAATTAATAAAAAGG + Intronic
1125035463 15:35118962-35118984 CTAAAATAGAAATCAGATTGTGG - Intergenic
1125099267 15:35891471-35891493 ATAAAATAGAAATCAGAGAGAGG + Intergenic
1125116447 15:36098508-36098530 CTAAAATAAATGTCAGTGAAAGG + Intergenic
1125129542 15:36266727-36266749 CTAAAACAGAATTATGAAAAAGG - Intergenic
1125425353 15:39543185-39543207 CTAAAATAGAACTTAGGAGATGG + Intergenic
1125463525 15:39928476-39928498 ATAAAAGAGAAGTCCTAAAAAGG - Intergenic
1126062574 15:44797459-44797481 TTAAAAGACAAGACAGAAAAAGG - Intergenic
1126233618 15:46355576-46355598 CAGAAATAGAATTCAGAATATGG + Intergenic
1126286868 15:47022985-47023007 CTAAGACCAAAGTCAGAAAAAGG + Intergenic
1126364722 15:47882392-47882414 CTACAACAGAAGTCACAAATTGG - Intergenic
1126506017 15:49405724-49405746 CAGAAATAGAATTCAGAATATGG - Intronic
1126595359 15:50379550-50379572 ATAAAATAAAAATCATAAAATGG + Intergenic
1126766637 15:52017219-52017241 CTGAAAAAGGAGTCAGCAAAGGG + Intronic
1127286050 15:57534632-57534654 CTGAAATCAAAGCCAGAAAAGGG + Intronic
1127342447 15:58062126-58062148 CTAAAATAGAAGAGGCAAAAAGG - Intronic
1127382717 15:58443761-58443783 CTGAAAAAGGAGTCAGCAAAGGG + Intronic
1127676061 15:61240334-61240356 CAGAAAAAAAAGTCAGAAAAGGG - Intergenic
1128850054 15:70945148-70945170 ATGAAATAGAAGTCAGAATTTGG - Intronic
1128968469 15:72085599-72085621 CAGAAATAGAATTCAGACAATGG - Intronic
1129443700 15:75601219-75601241 CTGAAATAGAAATTAGAACAAGG + Intronic
1130175428 15:81564319-81564341 CAAAAATAGAAGTCTAAGAACGG - Intergenic
1130795149 15:87199992-87200014 CTAAGACAGTAATCAGAAAATGG + Intergenic
1131001693 15:88943723-88943745 CTAAAATAGGAGACTGAAAAGGG + Intergenic
1131219739 15:90572571-90572593 AAAAAATAGAAATCAAAAAAAGG - Intronic
1131442368 15:92468554-92468576 CTATAATACAAGGCAGAATATGG - Exonic
1131480770 15:92779808-92779830 CCAAAAAAGGAGTCAGCAAAGGG + Intronic
1131597681 15:93814318-93814340 CAGAAATAGAATTCAGAATATGG + Intergenic
1131936985 15:97517336-97517358 CTAAAATAAAATTTAAAAAATGG + Intergenic
1132103713 15:99047406-99047428 GTAAAATAGAAGGAAGAAATGGG + Intergenic
1133476703 16:6129313-6129335 AAAAAATGGAAGTCATAAAAAGG + Intronic
1134313426 16:13096895-13096917 CTAAAATAGGCGTCAGAGAATGG - Intronic
1134532262 16:14992690-14992712 ATATAATAGAGGTCAGAAACAGG + Intronic
1134585798 16:15409615-15409637 CCAAAAAAGGAGTCAGCAAAGGG - Intronic
1134861660 16:17565648-17565670 CTATAATAGAAGTCCGAAAAGGG + Intergenic
1135638953 16:24103553-24103575 CTAAAATAAAAGTTGAAAAAAGG - Intronic
1136226719 16:28864775-28864797 CTAAAATAGAAATTAGAGAAAGG - Intronic
1136281492 16:29214488-29214510 ATAAAATAGACGTCCGAACAAGG + Intergenic
1136311963 16:29418612-29418634 CCAAAAAAGGAGTCAGCAAAGGG - Intergenic
1136325404 16:29520408-29520430 CCAAAAAAGGAGTCAGCAAAGGG - Intergenic
1136440092 16:30260390-30260412 CCAAAAAAGGAGTCAGCAAAGGG - Intergenic
1137257576 16:46789876-46789898 CTAAAAAGGAAATAAGAAAATGG + Intronic
1137286405 16:47019594-47019616 CTAAAATAAAAGTCACAACCTGG - Intergenic
1138004677 16:53321571-53321593 CTAAAAGAAAATTCAGAATATGG + Exonic
1138883775 16:61050159-61050181 CAGAAATAGAATTCAGAATATGG - Intergenic
1139863759 16:70047994-70048016 ATATAATAGAGGTCAGAAACAGG - Intergenic
1139886593 16:70212679-70212701 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
1140017991 16:71206590-71206612 CAGAAATAGAATTCAGAATATGG + Intronic
1140793401 16:78413361-78413383 CTGAAAAAGGAGTCAGCAAAGGG + Intronic
1142019984 16:87776146-87776168 CCAAAAAAGGAGTCAGCAAAGGG + Intergenic
1143486735 17:7259420-7259442 CTAACATGGAGGTCAGAGAAAGG + Intronic
1143716865 17:8779185-8779207 ATAAAATAGAAAATAGAAAAAGG + Intergenic
1144137656 17:12313958-12313980 CAAAAGTAGAATTCAGAATATGG - Intergenic
1145997438 17:29112742-29112764 GGAAAAAAGAAGTGAGAAAAGGG + Intronic
1146317116 17:31816081-31816103 CAAAAAAAGAAGAGAGAAAATGG + Intergenic
1146422452 17:32700640-32700662 ACAAATTAGAAATCAGAAAATGG + Intronic
1147650782 17:42060698-42060720 TAAAAATAGAAGTCAGAGGAGGG - Intronic
1147747944 17:42707200-42707222 TTAAAACAGTATTCAGAAAAGGG + Intronic
1148099746 17:45081693-45081715 CAAAAAAAGAAGAAAGAAAAAGG + Exonic
1148970976 17:51481398-51481420 CTAAAACAGAAGTTTTAAAAAGG - Intergenic
1149095835 17:52839518-52839540 ACAAAATAGAAGTCAGAAACGGG - Intergenic
1149249502 17:54752291-54752313 ACAAAATAGAAGTTAGAAAGGGG - Intergenic
1149274586 17:55018621-55018643 CCAAAAAAGGAGTCAGCAAAGGG + Intronic
1149319264 17:55468077-55468099 CCAAAAAAGGAGTCAGCAAAGGG - Intergenic
1149320502 17:55476409-55476431 CCAAAAAAGGAGTCAGCAAAGGG - Intergenic
1150050712 17:61959333-61959355 ATAAAGTAGAAGTGAGATAATGG - Intronic
1150308851 17:64110894-64110916 CGAAAACAGGACTCAGAAAAAGG + Intronic
1152043385 17:77919682-77919704 CCAAAAAAGGAGTCAGCAAAGGG - Intergenic
1152440450 17:80305572-80305594 TTAATATAGAATTCAGAATACGG - Intronic
1153061395 18:998508-998530 CTAAAATAAAAGTTAAATAAGGG + Intergenic
1153094451 18:1384280-1384302 CAGAAATAGAATTCAGAACATGG + Intergenic
1153399550 18:4667817-4667839 CAATAATAGAATTCAGAATATGG + Intergenic
1153695994 18:7642462-7642484 ATGAGATAGAAGTTAGAAAATGG + Intronic
1154402015 18:14048360-14048382 CTAAAATGAAAGTTAAAAAAAGG - Intergenic
1155466577 18:26142456-26142478 CTAAAAAAGAGGAGAGAAAAAGG + Intronic
1155753866 18:29465095-29465117 CTAATATAAAAGTTAAAAAAAGG + Intergenic
1156131162 18:33976483-33976505 CTGAAGTAGAAGTCCCAAAATGG + Intronic
1156800746 18:41110097-41110119 CAAAAATATAATTCAGAATATGG + Intergenic
1156925730 18:42575684-42575706 ATAAAATTGAATTCAGAAACAGG + Intergenic
1157056287 18:44232888-44232910 CAAAAATAGAAGCAAGAATAAGG - Intergenic
1157062481 18:44307698-44307720 CTAAAATAAAAATAGGAAAATGG - Intergenic
1157140113 18:45097015-45097037 CCAGAATACAAGTTAGAAAAGGG - Intergenic
1157645654 18:49267023-49267045 TTAAAATAGAAAACAAAAAATGG + Intronic
1157928976 18:51799108-51799130 CTGAAATTAAAGCCAGAAAAGGG - Intergenic
1158337319 18:56426872-56426894 CAGAAATAGAATTCAGAATATGG + Intergenic
1158662433 18:59400718-59400740 GTAAAATAGAGGAAAGAAAAAGG + Intergenic
1159106709 18:64010214-64010236 CTAAAATAGAAATTAGAGAACGG + Intergenic
1159117357 18:64130608-64130630 CTGAAATAAAAGTTTGAAAAAGG + Intergenic
1159130454 18:64275416-64275438 CTGAAAAAGGAGTCAGCAAAGGG + Intergenic
1159170450 18:64759277-64759299 CAAAAATAGAATTAAGAATATGG + Intergenic
1159245872 18:65804461-65804483 CTTAAATAAAAGTCTGATAATGG - Intronic
1159363530 18:67436203-67436225 CTAACATACAATACAGAAAATGG + Intergenic
1159395651 18:67852791-67852813 CTAAAATAAAAGTTAAAAAAGGG - Intergenic
1159481272 18:68993972-68993994 TTAAACTAGAAGTCATAAATAGG - Intronic
1159524747 18:69573664-69573686 ATAAAATCAAAATCAGAAAAGGG - Intronic
1159576913 18:70190449-70190471 CTAACATAGAAGAGAAAAAAAGG + Intronic
1159672035 18:71232885-71232907 CTAAAATAAAAAAGAGAAAATGG - Intergenic
1159918742 18:74208796-74208818 CTAAACAAGAAGCCAGAAGAAGG + Intergenic
1160082221 18:75738839-75738861 ATAAAATAGAATCCAGAAACAGG + Intergenic
1162875888 19:13620721-13620743 CTAAAAAAGAAATCAGAGACCGG + Intronic
1162986844 19:14276281-14276303 CCAAAAAAGGAGTCAGCAAAGGG - Intergenic
1164037021 19:21464358-21464380 CTCAAAAAGAAATAAGAAAAAGG + Intronic
1164259266 19:23554943-23554965 CTGAAAAAGGAGTCAGCAAAGGG - Intronic
1164951741 19:32343210-32343232 CTAAAATTGAAGGAAAAAAAAGG + Intergenic
1166411387 19:42557679-42557701 CTGAAAAAGGAGTCAGCAAAGGG - Intronic
1166653282 19:44591583-44591605 CCAAAAAAGGAGTCAGTAAAGGG + Intergenic
1167828252 19:51995015-51995037 CCGAAAAAGGAGTCAGAAAAGGG + Intronic
1167900815 19:52621000-52621022 CCAAAAAAGGAGTCAGCAAAGGG - Intronic
1167901704 19:52627203-52627225 CTGAAAAAGAAGTCAGCAAAAGG - Intronic
1168209539 19:54880527-54880549 CAGAAATAGAATTCAGAATATGG - Intronic
925647074 2:6046098-6046120 CAGAAATAGAATTCAGAATATGG + Intergenic
925984266 2:9203304-9203326 CTAACATAAAACACAGAAAATGG + Intergenic
926861213 2:17311175-17311197 CAATATTTGAAGTCAGAAAAAGG + Intergenic
926865418 2:17351886-17351908 GTAAAATTGAAGTGAGGAAAAGG + Intergenic
926993934 2:18713860-18713882 CTAAAATAGAAGATAAAAAATGG - Intergenic
927005613 2:18844883-18844905 ATAAATTAGAACTCTGAAAATGG + Intergenic
927565216 2:24105629-24105651 CAGAAATAGAATTCAGAATATGG + Intronic
928303819 2:30148722-30148744 CTTAAATAGAAAACAGAAAAGGG - Intronic
928363183 2:30681796-30681818 CTAAACTAGAAGACAGCCAAGGG - Intergenic
928462039 2:31484290-31484312 CAGAAATAGAATTCAGAATATGG - Intergenic
928478842 2:31660155-31660177 TTGAAATGGAAGTCAGACAAAGG + Intergenic
928774014 2:34737047-34737069 CCAAAAAAGGAGTCAGCAAAGGG - Intergenic
928877015 2:36052106-36052128 CAGAAATAGAATTCAGAATATGG - Intergenic
928993284 2:37258534-37258556 CTAAAATAGAGGTCAGAAAGTGG + Intronic
929199916 2:39224138-39224160 CTAAAATAGAAATGAGATATTGG - Intronic
929229729 2:39547094-39547116 TTACCAAAGAAGTCAGAAAAAGG - Intergenic
929621208 2:43356046-43356068 CTGAAATTTAAGACAGAAAACGG + Intronic
929940802 2:46332712-46332734 ATAACATAGAGGTGAGAAAATGG - Intronic
930229555 2:48828894-48828916 CAGAAATAGAATTCAGAATATGG + Intergenic
930275610 2:49307412-49307434 ATCAAATAGCAGTTAGAAAAGGG - Intergenic
930278007 2:49336215-49336237 GTAAAATAGAAATCGCAAAAGGG - Intergenic
930448715 2:51507248-51507270 CAAAGATACAAGTCAGAAAGGGG - Intergenic
930520418 2:52458376-52458398 CTAAAATAGAAGTTTTAAATAGG + Intergenic
930586094 2:53268461-53268483 CAGAAATAGAATTCAGAATATGG + Intergenic
930652210 2:53973690-53973712 CTGAAAAAGGAGTCAGCAAAGGG - Intronic
930706137 2:54506954-54506976 CCAAAAAAGGAGTCAGCAAAGGG + Intronic
931255041 2:60563716-60563738 CTAAAATAAAAGAAAAAAAATGG - Intergenic
931903613 2:66819521-66819543 CTAAAACAAAAGTTAAAAAAAGG - Intergenic
932143924 2:69302496-69302518 AGATAATAGAAGGCAGAAAAGGG + Intergenic
932469157 2:71942631-71942653 CAAAAATATAAATCAGAAACTGG - Intergenic
932512155 2:72303661-72303683 CAGAAATAGAATTCAGAATATGG - Intronic
932539827 2:72640031-72640053 CAAAAACAGAATTCAGAATATGG + Intronic
932782562 2:74570333-74570355 CAAAAAGAGAAGTAAGAAAGGGG + Intronic
933124028 2:78581208-78581230 TAAAAATACAAGTAAGAAAAAGG - Intergenic
933128809 2:78646775-78646797 CTAAAATTGAAGTGAGTACAGGG + Intergenic
933371860 2:81425000-81425022 CTAACATAGATGACAGAGAATGG - Intergenic
933408568 2:81895336-81895358 ATGAAATAGAAGTAGGAAAAAGG - Intergenic
933748597 2:85588595-85588617 CACAGATAGAAGTAAGAAAATGG - Intronic
934144730 2:89080697-89080719 CTATAATAAAAGACTGAAAAAGG - Intergenic
934224525 2:90119854-90119876 CTATAATAAAAGACTGAAAAAGG + Intergenic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
935527231 2:104185095-104185117 GTCCAAAAGAAGTCAGAAAAAGG - Intergenic
936030852 2:109069204-109069226 ATAAAATAGAGATCATAAAAAGG + Intergenic
936107761 2:109640081-109640103 AAAAAATAGAAGGCAGAAGAAGG - Intergenic
936640410 2:114305165-114305187 ATAAATTAGACTTCAGAAAAAGG - Intergenic
936812158 2:116414591-116414613 CAAAAATAGAATTCAGAATATGG + Intergenic
936997338 2:118429289-118429311 CTATAATAGAAGTATGAACAAGG + Intergenic
937058740 2:118965663-118965685 CTAAAATAGAAGTTTTAAATAGG - Intronic
937137610 2:119567908-119567930 CTAAAAGAAAAGAGAGAAAATGG - Intronic
937397316 2:121548081-121548103 CAAAAATAGAATTTAGAATATGG + Intronic
937521123 2:122713091-122713113 CAGAAATAGAATTCAGAATATGG + Intergenic
937703680 2:124893188-124893210 CCAAAATAGCAGCCAGAAAGTGG - Intronic
938229147 2:129643176-129643198 CTGAAATAGAAACCAGAAGAGGG - Intergenic
938566042 2:132520074-132520096 ATAAATTATAAGTCAGAAAAAGG - Intronic
938793126 2:134694200-134694222 ATAAAAGAGGAGTTAGAAAAAGG + Intronic
939089177 2:137758412-137758434 CAGAAATAGAATTCAGAATATGG + Intergenic
939274975 2:139989415-139989437 CAAAAATAGAATTCAGAATATGG - Intergenic
939304513 2:140393580-140393602 CTGAAATAGAAGATGGAAAATGG - Intronic
939588934 2:144039686-144039708 CTCAAACAGAAGTCAGGAAAAGG - Intronic
939590512 2:144058574-144058596 ATAAATTAGAAGCCAGAAATTGG - Intronic
939644383 2:144678726-144678748 CAAAAGTTGTAGTCAGAAAAAGG - Intergenic
939712338 2:145538056-145538078 CTAAAATATTAGCAAGAAAATGG - Intergenic
940149481 2:150583719-150583741 CTAAAATAAAAGTTAAAAAAAGG + Intergenic
940385397 2:153065430-153065452 CTAAATTAGACCTCAGATAATGG + Intergenic
940447385 2:153792058-153792080 CTAAAATAAAAGTTAAAACATGG + Intergenic
940456817 2:153912381-153912403 CAGAAATAGAATTCAGAATAAGG - Intronic
940726983 2:157345336-157345358 CCAAAAAAGGAGTCAGCAAAGGG - Intergenic
940895289 2:159075792-159075814 CTAAAATAAAATTCATACAAAGG - Intronic
941405950 2:165088589-165088611 CTAAAATAAAAGTTAGATAATGG - Exonic
941527733 2:166627709-166627731 CAGAAATAGAATTCAGAATATGG - Intergenic
941566525 2:167115336-167115358 CAGAAATAGAATTCAGAATATGG - Intronic
941898811 2:170658096-170658118 GTAAAATAAAAGTTAAAAAAAGG - Intergenic
942405366 2:175647884-175647906 CAGAAATAGAATTCAGAATATGG + Intergenic
942626092 2:177902338-177902360 CTGAAAAAGGAGTCAGCAAAGGG - Intronic
942634465 2:177987942-177987964 GTAAAATTAAAGTCAGAAAGAGG + Intronic
942857922 2:180573822-180573844 ATAAAATTGAGGTCACAAAATGG + Intergenic
942953377 2:181747533-181747555 TTAAAATACAAGTCACAAACTGG - Intergenic
943026130 2:182630881-182630903 ATTAAATTGAAGTAAGAAAATGG - Intergenic
943230711 2:185247226-185247248 CTGAAATGTAAATCAGAAAAAGG + Intergenic
943424457 2:187713343-187713365 ATAAAATATAAGTCAAAAAGTGG - Intergenic
943455734 2:188104178-188104200 CAGAAATAGAATTCAGAATATGG + Intergenic
943611788 2:190043667-190043689 CAGAAATAGAATTCAGAACATGG - Intronic
943810976 2:192189018-192189040 CTAAAATAAAAGTTTAAAAAAGG + Intronic
943828410 2:192426184-192426206 CTCCAATGCAAGTCAGAAAATGG - Intergenic
944185147 2:196939993-196940015 AAAAAATATAGGTCAGAAAAGGG + Intergenic
944983387 2:205147473-205147495 AGAAAATAAAAATCAGAAAATGG - Intronic
945016180 2:205519554-205519576 CACAAATAGAATTCAGAATATGG - Intronic
945366402 2:208959884-208959906 CAGAAATAGAATTCAGAATATGG + Intergenic
945560512 2:211333761-211333783 CTAAACTAGAAGTGAAAAAAAGG + Intergenic
945562301 2:211353976-211353998 CTGAAACAGGACTCAGAAAATGG - Intergenic
945621013 2:212137172-212137194 TTAAAATAAAAGTTAAAAAAAGG - Intronic
945661915 2:212696858-212696880 CCAAAATAGAAGTGATTAAAAGG - Intergenic
945675128 2:212846679-212846701 CTGAAATAAAAGTCAAAAAATGG + Intergenic
945816538 2:214611666-214611688 CCAAAACAGAGGTCAGGAAATGG - Intergenic
946804952 2:223462692-223462714 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
947438538 2:230095356-230095378 CTAAAATAAAGGTTGGAAAAGGG - Intergenic
947598668 2:231430772-231430794 CCAAAAAAGGAGTCAGCAAAGGG - Intergenic
947679359 2:232016051-232016073 CTACAATAGAAGTGAGAAATTGG + Intronic
948252922 2:236544875-236544897 ATAATATAGAAGACAGAATATGG + Intergenic
949054166 2:241915982-241916004 CAGAAATAGAATTCAGAATATGG + Intergenic
949069734 2:242017243-242017265 CCAAAATACAAGTCAGAACAGGG + Intergenic
1169265722 20:4166343-4166365 AAAAAAAAGAAGTCAGACAAAGG - Intronic
1169286894 20:4316271-4316293 CTAAAAAATAAATCACAAAAAGG + Intergenic
1169577713 20:6984064-6984086 CAGAAATAGAATTCAGAATATGG + Intergenic
1169665254 20:8027043-8027065 CTAATAAAGAAGACAGACAAAGG - Intergenic
1169692482 20:8347430-8347452 CCAAACCAGAAGGCAGAAAAGGG + Intronic
1169814983 20:9647092-9647114 CTAAAATAGAAACCTAAAAATGG - Intronic
1169963665 20:11191334-11191356 CTAATAGAAAAGACAGAAAAGGG + Intergenic
1170095552 20:12642280-12642302 CTAGAATGGAGATCAGAAAAAGG + Intergenic
1170184361 20:13571661-13571683 GTAAAATACAAGTCAGGTAATGG + Intronic
1170273675 20:14557427-14557449 GTAAAATACAGGTCACAAAATGG + Intronic
1170504235 20:17008361-17008383 CCAAAAAAGGAGTCAGCAAAGGG + Intergenic
1170611879 20:17921092-17921114 CTAAAATACAAAACAGAATAGGG + Intergenic
1171081616 20:22192061-22192083 CAGAAATAGAATTCAGAATATGG + Intergenic
1171117884 20:22542323-22542345 CTAAAATAAAAGCGACAAAAAGG - Intergenic
1171281826 20:23907126-23907148 TAAAAATAGAAGTCAGCACAAGG - Intergenic
1171281958 20:23908755-23908777 CACAAATAGAACTCAGAATATGG - Intergenic
1171491388 20:25520717-25520739 CAACAGTAGAAGTCAGAAGACGG - Intronic
1173045851 20:39510966-39510988 AGAAAAGAGAAGTCAGAAAAAGG + Intergenic
1173711887 20:45165138-45165160 CAGAAATAGAATTCAGAATATGG + Intergenic
1173752779 20:45489845-45489867 CAAAAATAGAAATCAGAAAGTGG - Intergenic
1173928428 20:46798363-46798385 CTAAAATAGAAATCAGATCAGGG + Intergenic
1174932477 20:54830892-54830914 CAGAGCTAGAAGTCAGAAAAAGG - Intergenic
1176585884 21:8584790-8584812 CTAGAAAAGAAGGAAGAAAAGGG + Intergenic
1176837150 21:13803765-13803787 CCAAAAAAGGAGTCAGCAAAGGG - Intergenic
1177299903 21:19229785-19229807 ATCACATACAAGTCAGAAAAAGG + Intergenic
1177457358 21:21357441-21357463 CTCAAATAGAAATCACCAAAAGG + Intronic
1177936450 21:27352336-27352358 TTAAAATAAAAGTCAAAAACAGG + Intergenic
1178039270 21:28621559-28621581 CCAAAAAAGGAGTCAGCAAAGGG + Intergenic
1178661275 21:34509756-34509778 CTAAAATAAAAGTTGAAAAAGGG - Intergenic
1178771951 21:35513243-35513265 CTCAAATAGCAGTAAGCAAACGG - Intronic
1179021427 21:37644370-37644392 TTAAAATAAAAGTTAAAAAAAGG + Intronic
1179766550 21:43578023-43578045 CCAAAAAAGGAGTCAGCAAAGGG - Intronic
1180268691 22:10561695-10561717 CTAGAAAAGAAGGAAGAAAAGGG + Intergenic
1180818411 22:18807881-18807903 CAAAAAAAGAAGTCAGAGAGGGG + Intergenic
1180837608 22:18938209-18938231 CCAAAAAAGGAGTCAGCAAAGGG + Intergenic
1181144236 22:20832873-20832895 CAGAAATAGAATTCAGAATATGG - Intronic
1181204633 22:21242336-21242358 CAAAAAAAGAAGTCAGAGAGGGG + Intergenic
1182039867 22:27229322-27229344 ACAAAATACAAGTCAGAAAGAGG - Intergenic
1182917174 22:34045041-34045063 ATAAAGTAGAATTCAGAAAATGG - Intergenic
1183517399 22:38274677-38274699 ATAAAATCGAAGTCAAAACATGG + Intergenic
1184053522 22:42027228-42027250 CTAAAATTGAAGTCAGGATAAGG + Exonic
1184885175 22:47340013-47340035 ACAAAATAAAAGCCAGAAAAAGG - Intergenic
1185378099 22:50491869-50491891 ATAAAATAGAAAACATAAAAAGG + Intergenic
1203222291 22_KI270731v1_random:53079-53101 CAAAAAAAGAAGTCAGAGAGGGG - Intergenic
1203268540 22_KI270734v1_random:33735-33757 CAAAAAAAGAAGTCAGAGAGGGG + Intergenic
1203287701 22_KI270734v1_random:163508-163530 CCAAAAAAGGAGTCAGCAAAGGG + Intergenic
949803867 3:7933467-7933489 CCAAAAAAGGAGTCAGCAAAGGG + Intergenic
949834414 3:8252456-8252478 CTAAAATAAAACTTAAAAAAAGG + Intergenic
949908651 3:8881671-8881693 CTAAATTTTAATTCAGAAAAAGG - Intronic
950826072 3:15822755-15822777 AAAAAATAGAAGTCACAGAAAGG + Intronic
950838142 3:15940348-15940370 TTAGAATAGAAGTCAGACAAGGG + Intergenic
951168017 3:19506131-19506153 CAGAAATAGAATTCAGAATATGG - Intronic
951310725 3:21123606-21123628 CTTAAATAAAAGTCACAGAAAGG - Intergenic
951340623 3:21482242-21482264 CTAAATCAGGAGTCAGTAAAGGG + Intronic
951745877 3:25976832-25976854 CTAAAAGAGAAGATAGAACATGG - Intergenic
951785622 3:26415584-26415606 CTAAAATAGAGAACAGAATAAGG + Intergenic
951947327 3:28154882-28154904 CCAGATTAGAAATCAGAAAAAGG - Intergenic
952454855 3:33463575-33463597 CTGAAAAAGGAGTCAGCAAAGGG + Intergenic
952661529 3:35856026-35856048 CTAAAATACAACACTGAAAAAGG - Intergenic
952791709 3:37205729-37205751 CCAAAAAAGGAGTCAGCAAAGGG - Intergenic
953066842 3:39481021-39481043 AGAAAATAGAAGGTAGAAAAAGG - Intronic
953104390 3:39861509-39861531 CAGAAATAGAATTCAGAACATGG + Intronic
953833900 3:46326826-46326848 CCAAAAAAGGAGTCAGCAAAGGG + Intergenic
954522472 3:51241900-51241922 CAGAAATAGAATTCAGAATATGG - Intronic
955047176 3:55371473-55371495 AAAAAATAGAAGTTATAAAATGG - Intergenic
955315035 3:57931365-57931387 ATAAATTAGAAATCACAAAAGGG - Intergenic
955319506 3:57964277-57964299 CTAAAATAGAAATATAAAAAGGG - Intergenic
955681270 3:61504703-61504725 CAGAAATAGAATTCAGAATATGG - Intergenic
955953249 3:64263122-64263144 CTAAAAAAGAAAACAAAAAAAGG - Intronic
956335978 3:68164332-68164354 CTCAAGTAGAATTCTGAAAAGGG + Intronic
956371946 3:68572089-68572111 CAGAAATAGAATTCAGAATATGG + Intergenic
956486522 3:69728701-69728723 CTCAAATAGAAATCAGAAGAGGG - Intergenic
956853215 3:73251576-73251598 TAAAAATAGAAGTCAGTACAGGG - Intergenic
957252334 3:77789228-77789250 CTATAATAAAAGTGAGAGAATGG - Intergenic
957394160 3:79618616-79618638 CTGAAAAAGGAGTCAGCAAAGGG - Intronic
957637418 3:82804732-82804754 ATTAAATAGAAGTCAGCACAAGG + Intergenic
957889582 3:86339102-86339124 ATAAACTAGAAATCAGAAATAGG + Intergenic
957935963 3:86943128-86943150 CTAAACTAGAATTTAGAGAATGG + Exonic
958073331 3:88642906-88642928 AGAAAATAGATGTCACAAAATGG + Intergenic
958148373 3:89657400-89657422 CTGAAATAGAATTCAGAATATGG - Intergenic
958740546 3:98065148-98065170 CTGAAAAAGAAGTCTGAGAAGGG + Intergenic
958742168 3:98087854-98087876 CTGAAAAAAAAGTCTGAAAAGGG + Exonic
958743551 3:98105424-98105446 CTGAAAAAGAAGTCTGAGAAGGG + Intergenic
959050138 3:101516795-101516817 CTAAAATAAAAGTCAAAAAAGGG + Intergenic
959345189 3:105185712-105185734 CTAAAATAAAAGTTGAAAAAGGG - Intergenic
959439305 3:106357605-106357627 CAGAAATAGAATTCAGAATATGG - Intergenic
959914619 3:111802771-111802793 ATAAACTAGAAGTGAAAAAATGG - Intronic
960045539 3:113193785-113193807 CTAAAATGGAAAGCAAAAAAGGG + Intergenic
960132210 3:114069240-114069262 CAAAAATAAAAGTTAAAAAAAGG - Intronic
960343033 3:116498182-116498204 CAGAAATAGAATTCAGAATATGG + Intronic
960346567 3:116539776-116539798 CAGACATAGAAGTCAGAATATGG + Intronic
960360361 3:116703708-116703730 AAAAAATAGAAGTTAAAAAACGG + Intronic
960591577 3:119371648-119371670 CTAAAATAAAAGTTAATAAAAGG - Intronic
960633400 3:119756595-119756617 GTAATATATAAGTCAGAAGAGGG + Intronic
960633692 3:119760697-119760719 ATAAAATAGAAATCAGTAACAGG + Intronic
960688209 3:120314733-120314755 CAGAAATAGAATTCAGAATATGG + Intergenic
960785656 3:121370984-121371006 CAGAAATAGAATTCAGAATATGG - Intronic
960893452 3:122476619-122476641 CTCAAAAAGAAGACATAAAATGG + Intronic
961265791 3:125641575-125641597 CCAAAAAAGGAGTCAGCAAAGGG + Intergenic
961343755 3:126247660-126247682 CTGAAAAAGAAGTCAGCAAAGGG - Intergenic
962212802 3:133492818-133492840 CAGACATAGAATTCAGAAAATGG + Intergenic
962228278 3:133634977-133634999 GAAAAATAGAAGAGAGAAAAGGG + Intronic
962459894 3:135600940-135600962 TGAAATAAGAAGTCAGAAAAAGG - Intergenic
962791888 3:138818945-138818967 CTACATTATAAGTCATAAAAAGG + Intronic
962842337 3:139246721-139246743 ATCCAATAGAAGTTAGAAAAAGG - Intronic
963389713 3:144644987-144645009 CTAAATGAAAAGTAAGAAAAGGG + Intergenic
963426364 3:145132661-145132683 GTAAAAAAGAAGAAAGAAAATGG - Intergenic
963617137 3:147555521-147555543 CTAATATAGAAGCCAGGATAAGG - Intergenic
963765485 3:149331010-149331032 CTAAAATAAAATTTAAAAAAAGG - Intronic
963774960 3:149429326-149429348 CTTAAATAGAATTAAGAAAAGGG + Intergenic
965258020 3:166442274-166442296 CTAAAATAAGAGACAGCAAAGGG - Intergenic
965317916 3:167213207-167213229 CAGAAATAGAATTCAGAATATGG + Intergenic
965334198 3:167416042-167416064 CTAAAACAGAAGTTAAAAAAAGG - Intergenic
965392168 3:168118367-168118389 CTAAAATAAAAGTTAAAAAATGG - Intergenic
965435140 3:168640969-168640991 CAAAAATTGCAGTCAGAAAAGGG + Intergenic
965443186 3:168742110-168742132 ATAAAACAGATGTCAAAAAATGG - Intergenic
966069203 3:175854476-175854498 TTAAAATTGAAAGCAGAAAAAGG - Intergenic
966409939 3:179637412-179637434 ATAAAATAAATATCAGAAAAGGG - Intergenic
966794871 3:183703803-183703825 TCAAAATAGAATTCAGGAAATGG + Intronic
966827355 3:183976210-183976232 CAAAAAGAGAAGAAAGAAAAAGG - Intronic
967003120 3:185355684-185355706 TTAAAATGAAGGTCAGAAAAAGG + Intronic
967330315 3:188283525-188283547 CTGAACTGCAAGTCAGAAAAAGG - Intronic
967768617 3:193309866-193309888 CTAAAATAAAAGTTTAAAAAAGG - Intronic
968106951 3:196007982-196008004 CCAAAATACAAGTCAGAACAGGG - Intergenic
968412159 4:399703-399725 CTGAAAAAGGAGTCAGCAAAGGG + Intergenic
968413567 4:409000-409022 CCAAAAAAGGAGTCAGCAAAGGG + Intergenic
969395282 4:6916586-6916608 CTTCAATACAAGTCAGAAAGCGG - Intronic
969935875 4:10680523-10680545 TTAAAAAAGAAGACAAAAAAGGG + Intronic
970596171 4:17602463-17602485 TAAAAATAGAAGTCAGCCAATGG + Intronic
970621884 4:17830617-17830639 ATATAATAGAAGTCACAAATGGG - Intronic
970631961 4:17956966-17956988 ATAAGATGGTAGTCAGAAAAAGG + Intronic
970679135 4:18487350-18487372 CTCAAAGAGCAATCAGAAAAAGG - Intergenic
970939758 4:21617979-21618001 CTAAAATATAAGTGACAGAAAGG + Intronic
971023559 4:22565060-22565082 GTAAAATAGATTTCAGAACAAGG + Intergenic
971103539 4:23496749-23496771 CCAAAAAAGGAGTCAGCAAAGGG - Intergenic
971605189 4:28650364-28650386 CAGAAATAGAATTCAGAATATGG - Intergenic
971610439 4:28718302-28718324 CTTAAATAAAAGTTAAAAAAAGG + Intergenic
971653765 4:29314499-29314521 CTAAAATAAACGTTAAAAAAGGG - Intergenic
971865603 4:32167146-32167168 ATAAAATATATGTCACAAAATGG + Intergenic
971980790 4:33747540-33747562 CCAAAAAAGGAGTCAGCAAAGGG + Intergenic
972495131 4:39627341-39627363 CTAGAATAGGAGTCAGATAGAGG - Intronic
972806388 4:42532979-42533001 CCAAAAAAGGAGTCAGCAAAGGG - Intronic
973838797 4:54839889-54839911 CTAAAATAAAAGTTTCAAAAAGG + Intergenic
974240240 4:59237447-59237469 CAGAAATAGAATTCAGAATATGG - Intergenic
974434888 4:61844207-61844229 CAAAAATAGCAGTCAAAAAAGGG + Intronic
975250539 4:72173497-72173519 CCAAAAAAGGAGTCAGCAAAGGG - Intergenic
975403541 4:73964716-73964738 CAGAAATAGAACTCAGAATATGG - Intergenic
975404225 4:73970218-73970240 CAAAAATAGAATTCAGATTATGG + Intergenic
975581481 4:75910896-75910918 CCAAAAAAGGAGTCAGCAAAGGG + Intergenic
975797094 4:78018224-78018246 CTAAAAGATCATTCAGAAAAAGG - Intergenic
975964117 4:79948955-79948977 CTAAAGGAGAAATCAGAGAAAGG - Intronic
975989946 4:80248395-80248417 TTAAAATAAAAGTTAAAAAAAGG + Intergenic
975999739 4:80359799-80359821 CAGAAATAGAATTCAGAATACGG - Intronic
976358786 4:84153286-84153308 CTAAAATAGCAAACAGAAAAAGG - Intergenic
976948342 4:90798452-90798474 CAGAAATAGAATTCAGAATATGG - Intronic
977014370 4:91674441-91674463 CTGAAATGGATGTGAGAAAAAGG - Intergenic
977035816 4:91951737-91951759 ATAAAATAGGAATCAGGAAAGGG + Intergenic
977393999 4:96449656-96449678 ATGAAATAGAATTCAGAATATGG - Intergenic
977427153 4:96881803-96881825 CTAAAATACAAGTTGGTAAAGGG + Intergenic
977482359 4:97594165-97594187 CAGAAATAGAATTCAGAATAAGG + Intronic
977743036 4:100509782-100509804 CTAAAATAGAAATGATACAATGG + Intronic
977819958 4:101459583-101459605 CAGAAATAGAATTCAGAATATGG + Intronic
977851452 4:101835099-101835121 AACAAATAGAAGACAGAAAAAGG - Intronic
978220660 4:106270244-106270266 CTCACAGAGAAGTTAGAAAACGG - Intronic
978292574 4:107161498-107161520 TTAAACTAGAAATCAGTAAAGGG + Intronic
978337495 4:107685403-107685425 CTAAAATTAAAGTAAGTAAAAGG + Intronic
978656090 4:111067338-111067360 TGAAAGTAGAAGTCAGAAAAGGG - Intergenic
978840896 4:113210229-113210251 CCAAAATAGAAGACAGAGCAGGG - Intronic
978859595 4:113432328-113432350 CTAAAATATCAGACAGCAAAAGG + Intergenic
978873405 4:113607702-113607724 CCAAAAAAGGAGTCAGCAAAGGG - Intronic
978885720 4:113763926-113763948 CTAAAATATAAATCAAAGAAAGG - Intergenic
978952780 4:114581508-114581530 CAAAAATAGAATTCAGAATATGG - Intergenic
978983270 4:114978693-114978715 CCAAAAAAAAAGCCAGAAAAGGG - Intronic
979078542 4:116304790-116304812 CTTAACTACAACTCAGAAAAAGG - Intergenic
979133821 4:117083849-117083871 GTAAAATAAAAGTACGAAAAAGG - Exonic
979164184 4:117505692-117505714 TTAAAATACAAGTCAAAAAATGG + Intergenic
979198094 4:117943853-117943875 CTAATATAGAAGGCATAAAAAGG - Intergenic
979804952 4:124960099-124960121 ATAAAATAGAAGAGAGAATAAGG + Intergenic
979872564 4:125843447-125843469 ATAAAATAAAAGTAACAAAAAGG - Intergenic
979908007 4:126321796-126321818 TTATAATATAAGTTAGAAAATGG - Intergenic
980257509 4:130401873-130401895 CTGAAATAGAATTCAGAATATGG - Intergenic
980532080 4:134069795-134069817 CAGAAATAGAACTCAGAATATGG - Intergenic
980583847 4:134788239-134788261 CATAAATAGAATTCAGAATATGG - Intergenic
980584990 4:134800846-134800868 TTAAAATGGATGTGAGAAAATGG + Intergenic
980593136 4:134917346-134917368 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
980639573 4:135558961-135558983 CTAAAATTGAATTTAAAAAATGG - Intergenic
980662673 4:135884292-135884314 CTAGAATAAAAGTCATAAATAGG - Intergenic
980824661 4:138059170-138059192 CTAAAATAAAAGTTAAAAAAAGG - Intergenic
980828225 4:138097518-138097540 CGAAAATAGGAGAGAGAAAAAGG + Intergenic
980829515 4:138113013-138113035 CAAAAAAAGGAGTCAGCAAAGGG + Intergenic
981482971 4:145256654-145256676 CCAAAAAAGGAGTCAGCAAAGGG + Intergenic
981528246 4:145729261-145729283 TTAAAATAAAGGCCAGAAAATGG - Intronic
981554685 4:145980108-145980130 CTCAAATAGAAATGAGCAAAAGG + Intergenic
981627519 4:146776265-146776287 CAGAAATAGAATTCAGAATATGG - Intronic
982015100 4:151145558-151145580 CCAAAAAAGGAGTCAGCAAAGGG - Intronic
982022641 4:151218937-151218959 ATAAAGCAGAAGTCAGCAAATGG - Intronic
982499233 4:156132037-156132059 CAGAAATAGAATTCAGAATATGG + Intergenic
982593317 4:157344892-157344914 CTAAAATAGAATTCAGAATTTGG + Intronic
982604887 4:157502543-157502565 CTAAAACAGAAATCACTAAAAGG - Intergenic
982730327 4:158948985-158949007 CTAACAAAGGATTCAGAAAAAGG - Intronic
983114747 4:163800262-163800284 CTAAAATAAAAATCAGAAAAAGG + Intronic
983487808 4:168352686-168352708 CAGAAATAGAATTCAGAACATGG - Intergenic
983547159 4:168976452-168976474 CTGAAAAAGGAGTCAGCAAAGGG + Intronic
984144325 4:176043314-176043336 CAGAAATAGAATTCAGAATATGG - Intergenic
984355463 4:178653177-178653199 CTTAAATTATAGTCAGAAAATGG - Intergenic
984636925 4:182120971-182120993 ACAAAATGGAAGTCAGAACATGG - Intergenic
985198521 4:187459589-187459611 CTAATAGAGAAGTCTGAGAAAGG + Intergenic
985831587 5:2237721-2237743 CTAAAATAAAAGTTACGAAAAGG + Intergenic
986168957 5:5300058-5300080 CTAAGAGAGAAGGCAGAGAATGG + Intronic
986537978 5:8812593-8812615 CTAAAATAGAAGTTGGATAAAGG + Intergenic
986654861 5:10000728-10000750 CAGAAATAGAATTCAGAATATGG + Intergenic
986877957 5:12133358-12133380 CAGAAATAGAATTCAGAATATGG + Intergenic
986930413 5:12812408-12812430 ATAAAATATCATTCAGAAAAAGG + Intergenic
987263863 5:16230960-16230982 CTAAAAAAGAATTCAAAACATGG + Intergenic
987502188 5:18727317-18727339 TTAAAATAAAAGTTAAAAAAAGG - Intergenic
988066365 5:26231619-26231641 CTGAAATACAAGTCAGAACGGGG - Intergenic
988336533 5:29914812-29914834 CAGAAATAGAATTCAGAATATGG + Intergenic
988348736 5:30072864-30072886 CAGAAATAGAATTCAGAATAAGG + Intergenic
988865120 5:35325525-35325547 CAAAAATAGAATTCAGCACATGG + Intergenic
988936129 5:36084403-36084425 CAGAAATAGAATTCAGAATATGG + Intergenic
989023131 5:37033950-37033972 TGAAAATACAAGTCACAAAATGG + Intronic
989046088 5:37275025-37275047 CCAAAAAAGGAGTCAGCAAAGGG - Intergenic
989133723 5:38132420-38132442 CTAAAATAAAAGTTAAAAAAAGG - Intergenic
989534136 5:42544203-42544225 ATAAAATAGCAGAAAGAAAAAGG + Intronic
990301490 5:54453450-54453472 ATAAATTAAAAATCAGAAAATGG - Intergenic
990313614 5:54563914-54563936 TTATAATTGAAGTCAGATAAAGG + Intergenic
990564575 5:57016543-57016565 CTGAAAAAGGAGTCAGCAAAGGG + Intergenic
992860888 5:80908418-80908440 ATAAAATAGACTTCAGAACAAGG + Intergenic
993080418 5:83290365-83290387 CTTAAATAGAATTAATAAAAGGG - Intronic
993219466 5:85072352-85072374 TTAAAATAGAAGTCCGCAGAGGG + Intergenic
993311592 5:86338913-86338935 CAAAAATAGAATTCAGAATATGG + Intergenic
993445000 5:88000902-88000924 GTAGAAAAGAGGTCAGAAAATGG - Intergenic
993634229 5:90325245-90325267 CAGAAATAGAATTCAGAATATGG - Intergenic
993639229 5:90381847-90381869 ATAAAACAGAGGTCAGATAAAGG + Intergenic
993678182 5:90843001-90843023 CTAACATAGACTTCAGTAAATGG + Intronic
993793537 5:92237101-92237123 CAGAAATAGAATTCAGAATATGG - Intergenic
993805662 5:92405770-92405792 TGAAAATAGTAGACAGAAAATGG + Intergenic
994084199 5:95740720-95740742 CTAGAATACAAGTCAGATCATGG + Intronic
994242637 5:97443258-97443280 CAGAAATAGAATTCAGAATATGG - Intergenic
994325524 5:98441226-98441248 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
994359001 5:98828566-98828588 CAGAAATAGAATTCAGAATATGG + Intergenic
994432799 5:99690468-99690490 GTAAAATAGAATTTAGAAAATGG - Intergenic
994520603 5:100829450-100829472 CTAAAATAGAATTCAGGCAAAGG - Intronic
994597832 5:101861357-101861379 CAGAAATAGAATTCAGAATATGG + Intergenic
994642947 5:102433241-102433263 CTGAAATAGAATTCAGAATATGG - Intronic
994769925 5:103968017-103968039 ATGAAATAGAAGTCATTAAAAGG - Intergenic
994790597 5:104221629-104221651 CTAAAATAAAGTTCATAAAATGG + Intergenic
994970629 5:106731794-106731816 CAGAAATAGAATTCAGAATATGG + Intergenic
995691507 5:114830733-114830755 CAGAAATAGAATTCAGAATATGG + Intergenic
995769120 5:115651095-115651117 CCAAAAAAGAAGTCAGCAAAGGG - Intergenic
995933084 5:117474400-117474422 CAAAATGAGAAGTTAGAAAATGG - Intergenic
995939395 5:117561853-117561875 TGATAATAGAAGTCAGAATATGG - Intergenic
996197540 5:120627877-120627899 CTAAGAAAGAAGAGAGAAAATGG - Intronic
996399991 5:123052038-123052060 CCAAAATACAAGTAACAAAATGG - Intergenic
996564885 5:124869272-124869294 CTAAAATAGAACACAACAAAAGG - Intergenic
996643179 5:125782706-125782728 GTAAAATACATGTCAGATAAAGG - Intergenic
996663289 5:126028397-126028419 CAGAAATAGAATTCAGAATATGG + Intergenic
997182103 5:131840824-131840846 CAGAAATAGAATTCAGAATATGG - Intronic
997801396 5:136866123-136866145 CTAATAAAGAAGTGAGTAAATGG + Intergenic
998611115 5:143689894-143689916 CTAAAAGAGAAGGGAGAGAATGG - Intergenic
998714081 5:144862205-144862227 TAAAAATAGAAGTAAGGAAAAGG - Intergenic
999097523 5:148993404-148993426 ATAAAATAGAAGATGGAAAAAGG + Intronic
999798684 5:155012031-155012053 ATGAAATAGAAGTCAGAAAGTGG - Intergenic
999811282 5:155129809-155129831 ATAAGATAGAGGTGAGAAAATGG - Intergenic
1000700414 5:164442773-164442795 ATAAAATAAAGCTCAGAAAAAGG - Intergenic
1000917163 5:167096299-167096321 TTAAAACATAAATCAGAAAAGGG - Intergenic
1000957142 5:167556828-167556850 CTAAAATACAAGTGAGACCAAGG - Intronic
1001302640 5:170547366-170547388 TTAAAATAAAAGTTAAAAAAAGG - Intronic
1001866327 5:175108880-175108902 CTAAAATGAAAGTAAGAAATAGG - Intergenic
1002353712 5:178605792-178605814 CTGAAGTAGAATACAGAAAACGG + Intronic
1003389588 6:5702047-5702069 ATAAAGCAGAAGTCAGAGAAAGG - Intronic
1003417538 6:5925830-5925852 CTAAAATAAAAATAAAAAAAAGG + Intergenic
1003654351 6:7992036-7992058 TTAAAATATAAGACAGTAAATGG + Intronic
1003738410 6:8905328-8905350 GTAACATGGAAATCAGAAAAAGG - Intergenic
1004104737 6:12655697-12655719 ATAAAATAGAAGTCAGGATGTGG + Intergenic
1004804332 6:19185809-19185831 CAAAAATAGTAATCATAAAATGG + Intergenic
1004805978 6:19204560-19204582 TGAAAATAGAATTCAGAATATGG - Intergenic
1004929608 6:20449616-20449638 TTAAAATAAAAGTTAAAAAAAGG - Intronic
1004956278 6:20731244-20731266 TTAAAACAGAAGCCAGAACATGG - Intronic
1005047160 6:21653388-21653410 CTAAAAAAGCAGACAGGAAAAGG + Intergenic
1005252029 6:23957902-23957924 TTAAAATGGAAATAAGAAAAAGG + Intergenic
1005516872 6:26563511-26563533 ATATAAAAGAGGTCAGAAAACGG + Intergenic
1005786843 6:29252456-29252478 CCAAAACAGAAGTCAGCAAAGGG + Intergenic
1006245092 6:32726494-32726516 CTGAAAGAGAAGAGAGAAAAAGG + Intergenic
1006256080 6:32833444-32833466 CTTAAAAAAAAATCAGAAAATGG + Intronic
1006659528 6:35628554-35628576 TTAAAATAGAGATCAGAAATTGG - Intronic
1007012777 6:38433622-38433644 CCAAAAAAGGAGTCAGCAAAGGG - Intronic
1007149468 6:39674146-39674168 CTAAAATATATGTCAGTAAAGGG - Intronic
1007942399 6:45794272-45794294 CTAAAACAGAGGTGGGAAAAGGG + Intergenic
1007967936 6:46019781-46019803 ACAAAATAGACTTCAGAAAAAGG + Intronic
1008173355 6:48235531-48235553 CAAAAATATAAATCAGAATATGG + Intergenic
1008332196 6:50258955-50258977 CAAAAATAGAATTCAGAAAATGG - Intergenic
1008763933 6:54886740-54886762 GTAAAATAGAAAAAAGAAAAAGG - Intronic
1009330656 6:62415667-62415689 CTAAAATAAAAGTTTAAAAAAGG + Intergenic
1009355167 6:62734915-62734937 CTAAATTAAAAGTCAAAAAAAGG + Intergenic
1009548251 6:65050122-65050144 CTAAAATAAAAATAAGAGAAAGG + Intronic
1009769435 6:68126405-68126427 CAGAAATAGAATTCAGAATAGGG - Intergenic
1009915534 6:69990888-69990910 CTAAAATAGAAGTCAGAAAAAGG - Intronic
1010114008 6:72279334-72279356 CTAGAGTAAAAATCAGAAAATGG - Intronic
1010131309 6:72497050-72497072 CTAAAATTGGAGGCAGAAGAAGG - Intergenic
1010295654 6:74193653-74193675 CAGAAATAGAATTCAGAATATGG - Intergenic
1010342817 6:74776308-74776330 ATAAAACAGAAGTGAGAACATGG - Intergenic
1010376292 6:75174622-75174644 CTTGAATGGAAGTCAGAAAATGG + Intronic
1010466038 6:76167413-76167435 CAGAAATAGAATTCAGAATATGG + Intergenic
1010495631 6:76531687-76531709 CAGAAATAGAATTCAGAATATGG - Intergenic
1010866448 6:80981576-80981598 CCAAAAAAGGAGTCAGCAAAGGG - Intergenic
1011221577 6:85060111-85060133 CTAAGATAGAACTGAGACAAAGG - Intergenic
1012794498 6:103742512-103742534 CTAAAATAAAAGGCAGATCATGG + Intergenic
1012926842 6:105275873-105275895 CTAAAAAAGCAGGCAGAGAAAGG + Intergenic
1013070428 6:106724096-106724118 TTTCAATAAAAGTCAGAAAATGG - Intergenic
1013322463 6:109008756-109008778 CTAAAGGACAATTCAGAAAAGGG + Intronic
1013356860 6:109353092-109353114 CTAAATTACAAGTCAATAAATGG + Intergenic
1013395097 6:109728267-109728289 CTAAAAGTGAATTCAGAAGAAGG + Intronic
1013699460 6:112747079-112747101 TTTACATAGAAGTCAGGAAAAGG + Intergenic
1013738054 6:113249804-113249826 CAGAAATAGAATTCAGAATATGG + Intergenic
1013960812 6:115897810-115897832 TTAAAATAAAACTCAGTAAAAGG - Intergenic
1014115605 6:117664863-117664885 CTGAAAAAGGAGTCAGCAAAGGG + Intergenic
1014208068 6:118678535-118678557 ATAAAATAGAGTTCAGTAAATGG - Intronic
1014446168 6:121530716-121530738 CTAAACTAGAAATCACAAATGGG - Intergenic
1014490816 6:122059247-122059269 CAAAAACAAAATTCAGAAAAAGG - Intergenic
1014633057 6:123811199-123811221 CTAAGCTAAAAGTCAGAAATAGG - Intronic
1014956623 6:127626455-127626477 CTAAAATAAAACTAAGAAAACGG - Intergenic
1015197397 6:130538150-130538172 CAGAAATAGAATTCAGAATATGG + Intergenic
1015246978 6:131085753-131085775 CAGAAATAGAATTCAGAATATGG + Intergenic
1015408304 6:132862574-132862596 CTAAATTAGAAGTAGGAACAAGG - Intergenic
1015488507 6:133799450-133799472 CAGAAATAGAATTCAGAATATGG - Intergenic
1016225395 6:141729251-141729273 TTAAAGTAAATGTCAGAAAAGGG - Intergenic
1016445646 6:144129417-144129439 CTAAAATAAAAGTCAAAAAAAGG + Intergenic
1016476986 6:144438374-144438396 TTAAAATAAAAGTCACAAAATGG - Intronic
1016617285 6:146066061-146066083 CCAAAATAAAAGTTGGAAAAGGG - Intronic
1016702918 6:147073727-147073749 AAAAAATAGAAGTGAGCAAAAGG - Intergenic
1016868446 6:148792676-148792698 TTAAAATAGATCCCAGAAAATGG - Intronic
1017994397 6:159520045-159520067 CAGAAATAGAATTCAGAATATGG - Intergenic
1018987975 6:168652213-168652235 CTAAAATTGATGGCAGTAAATGG + Intronic
1019054070 6:169208271-169208293 CTAGAAAACAAGTAAGAAAATGG + Intergenic
1020715418 7:11668716-11668738 CTAAAACAGAAGTATGAATAAGG + Intronic
1020735887 7:11949191-11949213 CAGAAATAGAATTCAGAATATGG - Intergenic
1020880989 7:13763317-13763339 CTCAGATAGAAATGAGAAAACGG + Intergenic
1021244273 7:18242701-18242723 AAAAAGTAGAAGGCAGAAAAGGG - Intronic
1021253802 7:18364446-18364468 GAAAAAGAGCAGTCAGAAAATGG + Intronic
1021377518 7:19926157-19926179 ATAAAATAGAAGCCATAAATAGG - Intergenic
1021530031 7:21633822-21633844 AAAAAATGGCAGTCAGAAAAGGG + Intronic
1022202724 7:28133309-28133331 GTAAAATTAAATTCAGAAAATGG + Intronic
1022754442 7:33270377-33270399 CAGAAATAGAATTCAGAATATGG + Intronic
1023191371 7:37586338-37586360 CGAAAATAAAATTAAGAAAATGG - Intergenic
1023336397 7:39175144-39175166 GAAAAATAGAGGACAGAAAAGGG - Intronic
1023886246 7:44359310-44359332 CAGAAATAGAATTCAGAATATGG - Intergenic
1024445924 7:49479059-49479081 TCAAAATAGAATTCAGAATATGG - Intergenic
1024833740 7:53491997-53492019 CTGTAACAGAAGTCAGAGAAAGG - Intergenic
1024957827 7:54943826-54943848 GTGAAATAGAATTTAGAAAATGG + Intergenic
1026289067 7:68989682-68989704 CTAAATTCGAAATCAGAAAGTGG + Intergenic
1026662276 7:72312796-72312818 TTAAAATAGAAGAGAGAATAAGG + Intronic
1027645947 7:80798237-80798259 CTAAAAAAGAAAACAGAAAAAGG + Intronic
1027835289 7:83233909-83233931 CTAACATATAAGCCAGATAAAGG - Intergenic
1028338693 7:89691284-89691306 ATAAAATTGAAGTCATTAAAAGG - Intergenic
1028765260 7:94549873-94549895 CAAAATTATAAGTCAGACAAAGG - Intronic
1028858007 7:95613688-95613710 CAGAAATAGAATTCAGAATATGG + Intergenic
1029136288 7:98374774-98374796 ATAAAATGGAAGAAAGAAAAAGG + Intronic
1029868695 7:103664169-103664191 CTATAACAGAAGTCATAAACTGG + Intronic
1030167263 7:106567727-106567749 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
1030374851 7:108743791-108743813 CAGAAATAGAATTCAGAATATGG - Intergenic
1030439970 7:109576918-109576940 CTCAAATAGAAGTGATAAGAAGG + Intergenic
1030459605 7:109816128-109816150 ATAAAGTAGACTTCAGAAAAAGG - Intergenic
1030846664 7:114423367-114423389 TTAAAAAAGAAGAAAGAAAAAGG + Intronic
1031039631 7:116826063-116826085 CAGAAATAGAATTCAGAATATGG - Intronic
1031222895 7:118994502-118994524 CTAAATGAGAAGTAAGAAAGTGG + Intergenic
1031430316 7:121660031-121660053 ATAAAAAAGAAGTCACAAAATGG - Intergenic
1031530562 7:122871100-122871122 CTAAGATAGAAAACTGAAAATGG + Intronic
1031702840 7:124945977-124945999 CAGAAATAGAATTCAGAAAATGG + Intergenic
1032206170 7:129867840-129867862 CTAAACTGGAAGCCAGAAGATGG + Intronic
1032310684 7:130783947-130783969 CTGAAATAGAAGATAGAAGATGG - Intergenic
1032598084 7:133262506-133262528 AATAAATAAAAGTCAGAAAAGGG - Intronic
1032775516 7:135109160-135109182 CAGAAATAGAATTCAGAATATGG - Intronic
1032838635 7:135696708-135696730 CTAAGGTAGAGGTGAGAAAATGG - Intronic
1032969327 7:137140642-137140664 CTAAAATAACAGTCAAAAAATGG + Intergenic
1033307176 7:140233287-140233309 CTAAAATAAAACTAAGAAATCGG + Intergenic
1033341159 7:140493290-140493312 ATAAATTAGATTTCAGAAAAGGG + Intergenic
1033612910 7:142983487-142983509 CAGAAATAGAATTCAGAATATGG - Intergenic
1033625323 7:143105394-143105416 CCAAAAAAGGAGTCAGCAAAGGG - Intergenic
1033626043 7:143110399-143110421 CCAAAAAAGGAGTCAGCAAAGGG - Intergenic
1033829335 7:145233475-145233497 ATAAAAAAAAAGACAGAAAATGG - Intergenic
1033899782 7:146122440-146122462 CTAATCTAGAACTCAGAGAAGGG + Intronic
1033928146 7:146489391-146489413 CTAAAAGAGCAGTAAGAGAAAGG - Intronic
1033943766 7:146688423-146688445 CTGAAAAAGGAGTCAGCAAAGGG + Intronic
1034206531 7:149320748-149320770 CCAAAATACAAGTCAGGAGAGGG + Intergenic
1034714144 7:153223631-153223653 CAGAAATAGAACTCAGAACAGGG - Intergenic
1034733451 7:153408443-153408465 ATCAAATAGAAGGCAGGAAAAGG - Intergenic
1035099567 7:156385037-156385059 CTAAAATGCAATTCACAAAAGGG - Intergenic
1035731412 8:1856232-1856254 CTAAAATTGAATCAAGAAAAAGG - Intronic
1036115279 8:5952650-5952672 CCAAAATAGAAGGCTTAAAATGG + Intergenic
1037227966 8:16618380-16618402 TTAAAATAGAAATCACAAACAGG - Intergenic
1037428098 8:18779428-18779450 CTAAATTAGAGGTGAAAAAAAGG - Intronic
1038159786 8:25025637-25025659 AGTAAATAGAAGTCAGAATAGGG + Intergenic
1038367425 8:26950197-26950219 TTAAAATAAATGTCAGGAAAAGG - Intergenic
1038976549 8:32703253-32703275 CAACAACATAAGTCAGAAAAGGG + Intronic
1039102559 8:33957022-33957044 CAGAAATAGAATTCAGAATACGG - Intergenic
1039109797 8:34029211-34029233 GTAAAATAGAAGAAAGATAAAGG + Intergenic
1039624089 8:39029852-39029874 CTAATATCAAAGTCAGACAAGGG - Intronic
1039730387 8:40269440-40269462 ATAAAATTGTAGACAGAAAAAGG - Intergenic
1040027985 8:42799188-42799210 CAACAATAGAAGTCAGAAGATGG + Intergenic
1040838456 8:51757835-51757857 CAAAAATAGAGCTCAGAAAAGGG - Intronic
1040893364 8:52339786-52339808 CTAAAATAGAACTCGGAAAGGGG - Intronic
1040944084 8:52864010-52864032 CAGAAATAGAATTCAGAATATGG - Intergenic
1041715717 8:60930225-60930247 CTAAAATAAAAGAAAAAAAATGG - Intergenic
1041728384 8:61039838-61039860 CTAAAATAAAAGTCAAAATTAGG - Intergenic
1042011975 8:64256686-64256708 TTAAAGTAGAAGCCTGAAAATGG - Intergenic
1042108515 8:65355055-65355077 CAGAAATAGAATTCAGAAAATGG - Intergenic
1042974200 8:74447143-74447165 CTGAAATATAAGTTAGAAAGAGG + Intronic
1043170465 8:76959524-76959546 ATAAAATAAAAGTAAGTAAAAGG - Intergenic
1043281026 8:78466250-78466272 CAGAAATAGAATTCAGAATATGG + Intergenic
1043288376 8:78564063-78564085 AGAAAATAGAAGCCAGTAAATGG - Intronic
1043721509 8:83550557-83550579 CCAAAAAAGGAGTCAGCAAAGGG - Intergenic
1043727385 8:83628468-83628490 CAGAAATAGAATTCAGAATATGG - Intergenic
1043727703 8:83630688-83630710 CAGAAATAGAATTCAGAATATGG + Intergenic
1044010870 8:86993430-86993452 CAAAAATAGAATTCAGAATCAGG - Intronic
1044162315 8:88935180-88935202 CAGAAATAGAATTCAGAAAATGG - Intergenic
1044271974 8:90255550-90255572 ATAAAGTAGATTTCAGAAAAAGG + Intergenic
1044360474 8:91277594-91277616 ATAAAATAGAACTCATAATATGG + Intronic
1044800955 8:95955307-95955329 CAAACATTGAAGACAGAAAAAGG - Intergenic
1045835859 8:106520921-106520943 AGAAAATAGAAGTCTCAAAAGGG + Intronic
1045910484 8:107401953-107401975 ATAAAATAATAGTCAGACAATGG + Intronic
1046075533 8:109307347-109307369 CCAAAAAAGGAGTCAGCAAAGGG - Intronic
1046157075 8:110305946-110305968 CTAAAATAACAGTTAAAAAAAGG + Intergenic
1046229921 8:111340756-111340778 CTAAAAGAGATGTAGGAAAATGG + Intergenic
1046550550 8:115710261-115710283 CTGAAAAAGGAGTCAGCAAAGGG - Intronic
1046590958 8:116206525-116206547 CTGAATTAGAAGTTAGATAAAGG + Intergenic
1046703902 8:117428890-117428912 CTAAAATATAAATAAGCAAATGG + Intergenic
1046895281 8:119464674-119464696 CAGAAATAGAATTCAGAATATGG + Intergenic
1046934785 8:119875271-119875293 CTAAAAACGGAGTCAGCAAAGGG + Intronic
1047159457 8:122361301-122361323 CAGAAATAGAATTCAGAATATGG - Intergenic
1047562506 8:126003418-126003440 CTATTATAGAAGTCACAATAAGG + Intergenic
1048504540 8:135008965-135008987 CTAAAATAGTAATCCAAAAAAGG + Intergenic
1048538924 8:135324695-135324717 CTAAAGTAGAACTCAAAGAATGG - Intergenic
1048661129 8:136602601-136602623 ATAAAAAACAATTCAGAAAAGGG + Intergenic
1048752280 8:137692792-137692814 ATACATTAAAAGTCAGAAAATGG + Intergenic
1049128268 8:140811579-140811601 CAGAAATAGAATTCAGAACATGG + Intronic
1049506905 8:143007562-143007584 CAGAAATAGAATTCAGAATATGG - Intergenic
1050075204 9:1855821-1855843 CTAAACTAGAACTTAGAAAATGG - Intergenic
1050157993 9:2687993-2688015 CAGAAATATAAGTAAGAAAATGG + Intergenic
1050213192 9:3288543-3288565 TTAAAATAGAAATTTGAAAATGG - Intronic
1051313795 9:15807191-15807213 CAGAAATAGAATTCAGAATATGG - Intronic
1051832585 9:21296680-21296702 CAGAAATAGAATTCAGAATATGG + Intergenic
1052139150 9:24956360-24956382 CGAAAATAGAAGACAGGAAAAGG - Intergenic
1052173461 9:25428724-25428746 CAGAAATAGAATTCAGAATATGG + Intergenic
1052311487 9:27073864-27073886 CAGAAATAGAATTCAGAATATGG - Intergenic
1052437601 9:28448609-28448631 ATACAATAGAAGTGAGAAAATGG + Intronic
1052703137 9:31961321-31961343 CAGAAATAGAATTCAGAATATGG + Intergenic
1052767115 9:32652023-32652045 CAAAAATAGAATTAAGAATATGG + Intergenic
1053074468 9:35121078-35121100 CCAAAAAAGGAGTCAGCAAAGGG - Intergenic
1053891085 9:42693688-42693710 CCAAAATTGAAGTCAGAGACAGG + Intergenic
1054220613 9:62408075-62408097 CCAAAATTGAAGTCAGAGACAGG - Intergenic
1054230101 9:62501097-62501119 CCAAAATTGAAGTCAGAGACAGG + Intergenic
1054966063 9:71027477-71027499 CAGAAATAGAACTCAGAATATGG + Intronic
1055168387 9:73224261-73224283 CAGAAATAGAATTCAGAATATGG + Intergenic
1055202389 9:73682395-73682417 CTGAAAAACAAGTAAGAAAATGG - Intergenic
1055303684 9:74907145-74907167 TGAAAAAGGAAGTCAGAAAATGG - Intergenic
1055365205 9:75536563-75536585 CTAAAATAAAAGTTGGAAAGAGG - Intergenic
1055390084 9:75811201-75811223 CTGAACTTGAAGGCAGAAAATGG + Intergenic
1055406190 9:75976138-75976160 CTGAAATACAAGTTAGAAAATGG + Intronic
1055411963 9:76040105-76040127 GTAAAAAAGAATTCAGAAACTGG - Intronic
1055820112 9:80252293-80252315 ATAAAAAACAAGTCAGAGAATGG - Intergenic
1055912423 9:81367925-81367947 CTAAAATAAAAGTTAAAAAATGG + Intergenic
1056053749 9:82798830-82798852 CTTAATTTGAAATCAGAAAAGGG - Intergenic
1056073761 9:83016671-83016693 CTAGCAGAGAAGACAGAAAAAGG + Intronic
1056127764 9:83553831-83553853 CAGAAATAGAACTCAGAATATGG - Intergenic
1056167794 9:83956001-83956023 TTAAAATAGAAGTATGAAAAGGG - Intronic
1056209170 9:84349094-84349116 CCAAAAAAGGAGTCAGCAAAGGG + Intergenic
1056267059 9:84907790-84907812 CTAAAATAGAACAAAGCAAAAGG - Intronic
1056332359 9:85531556-85531578 CTAAAAAATAAGTTAGTAAATGG - Intergenic
1056711261 9:88993761-88993783 CAAAAATAGGATTCAAAAAAGGG - Exonic
1056834339 9:89942483-89942505 CTAACATAGAATACGGAAAAGGG + Intergenic
1057281908 9:93719316-93719338 CTAAAATTGAAGACACCAAAAGG + Intergenic
1057323025 9:94031519-94031541 CTAAATTAGAGGTCACAAACTGG - Intronic
1057392410 9:94650808-94650830 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
1057638427 9:96794397-96794419 CAGAAATAGAATTCAGAATATGG - Intergenic
1057695394 9:97319330-97319352 CTAAAATAAAAGTTAAAAAAAGG - Intronic
1058025071 9:100133932-100133954 GAAAAATAGAAGTTAAAAAAAGG - Intronic
1058275392 9:103035643-103035665 TTTAAATAGTAGTGAGAAAATGG - Intergenic
1058315127 9:103555158-103555180 CAGAAATAGAATTCAGAATATGG + Intergenic
1058354710 9:104070649-104070671 CTAAAAGAGAAGTCAATCAAGGG + Intergenic
1058565299 9:106277779-106277801 CTAAAACAGAACACAGGAAAAGG + Intergenic
1058821804 9:108738889-108738911 AAAAAATTGAAGTGAGAAAAAGG + Intergenic
1059049387 9:110906242-110906264 ATATAATAGAAGACAGAGAATGG - Intronic
1059322872 9:113483036-113483058 CTAAAAGAGAATTCAGACATTGG - Intronic
1059868767 9:118546904-118546926 CAGAAATAGAATTCAGAATATGG + Intergenic
1059890163 9:118793034-118793056 CTATAATACAAGGCAGAAAGAGG - Intergenic
1060242503 9:121916566-121916588 ATAAAACAGAATACAGAAAAAGG + Intronic
1060336729 9:122730711-122730733 CAGAAATAGAATTCAGAATATGG + Intergenic
1060873274 9:127059972-127059994 CTAAATTAGAAGCCAAGAAAGGG + Intronic
1203615785 Un_KI270749v1:62308-62330 CTAGAAAAGAAGGAAGAAAAGGG + Intergenic
1185515638 X:697068-697090 CTGAAAAAGGAGTCAGCAAAGGG + Intergenic
1186079177 X:5912073-5912095 CTAAAATAAAAGTTTTAAAAAGG - Intronic
1186135126 X:6511214-6511236 CTAAAATAAAAGTTTAAAAAAGG + Intergenic
1186386648 X:9116645-9116667 CAAAAATAGAAGTTTAAAAAGGG - Intronic
1186907558 X:14127905-14127927 CTAAAATAAAAGTTCAAAAAAGG - Intergenic
1187104032 X:16221962-16221984 CCAAAAAAGGAGTCAGCAAAGGG + Intergenic
1187411910 X:19058659-19058681 CTAAAAGAAAAGTAACAAAAGGG + Intronic
1187641190 X:21292115-21292137 CAGAAATAGAATTCAGAATATGG - Intergenic
1187658056 X:21503556-21503578 ATAAAATTGAAGTAAGAACATGG - Intronic
1187776640 X:22767128-22767150 CAAATACAGAAGTAAGAAAATGG - Intergenic
1187836689 X:23438227-23438249 CCAAAAAAGGAGTCAGCAAAGGG + Intergenic
1188289622 X:28371473-28371495 CAGAAATAGAATTCAGAATATGG - Intergenic
1188963500 X:36522811-36522833 CAGAAATAGAATTCAGAATATGG - Intergenic
1189212698 X:39297942-39297964 TTTATATAGAAATCAGAAAATGG - Intergenic
1189289947 X:39877933-39877955 AAAAAAGAAAAGTCAGAAAAGGG - Intergenic
1189532842 X:41904610-41904632 CTAAAATAAAAGTTGGAAAGAGG - Intronic
1189717492 X:43881511-43881533 GAAAAATAGAAGCCAGAAGAAGG - Intronic
1190396910 X:49994292-49994314 CCATAATAGAATTCAGAGAAAGG + Intronic
1190600511 X:52088178-52088200 CAAAAGTAGAATTCAGAATACGG - Intergenic
1191217637 X:57950497-57950519 CAGAAATAGAATTCAGAATATGG - Intergenic
1191722662 X:64247730-64247752 CAAAAATAGAATTCAGAATATGG - Intergenic
1192067547 X:67902818-67902840 CAGAAATAGAATTCAGAATATGG - Intergenic
1192072881 X:67959807-67959829 CTAAGCTGGAAGTGAGAAAAGGG - Intergenic
1192115397 X:68405751-68405773 ATAAAATAGAGGTTAAAAAATGG - Intronic
1192848600 X:74930325-74930347 CTGAAAGAGAGGTGAGAAAAAGG + Intergenic
1193028215 X:76868698-76868720 CTCAAATATAAGTCACAGAATGG + Intergenic
1193067768 X:77277275-77277297 CAGATATAGAAGTTAGAAAATGG + Intergenic
1193089979 X:77483258-77483280 CAGAAATAGAATTCAGAATATGG + Intergenic
1193155291 X:78166027-78166049 CTCAAATAAAATTAAGAAAAAGG + Intergenic
1193162438 X:78242253-78242275 CAGAAATAGAATTCAGAATATGG + Intergenic
1193230410 X:79038267-79038289 CTAAAATAAAAGTTAAAAAATGG - Intergenic
1193250925 X:79289749-79289771 CAGAAATAGAATTCAGAATATGG + Intergenic
1193299172 X:79868522-79868544 CAAAAATAGAATTCAGAATATGG + Intergenic
1193428852 X:81375132-81375154 CTAAAGATGAAGTCAGAAAACGG - Intergenic
1193482775 X:82047556-82047578 CAGAAATAGAATTCAGAATATGG + Intergenic
1193497794 X:82236105-82236127 CATAAATATAAGTCAGAATATGG - Intergenic
1193522023 X:82542194-82542216 CTTAAATATAAGACATAAAATGG + Intergenic
1193536797 X:82727085-82727107 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
1193537622 X:82732837-82732859 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
1193559703 X:83002784-83002806 CTAAAATAAAAGTTTAAAAAAGG + Intergenic
1193607366 X:83584600-83584622 CAGAAATAGAATTCAGAATATGG + Intergenic
1193736284 X:85160349-85160371 CAGAAATAGAATTCAGAATATGG + Intergenic
1193752621 X:85365230-85365252 CAGAAATAGAATTCAGAATATGG - Intronic
1193821653 X:86172501-86172523 CTGAAATGTAAGTGAGAAAATGG + Intronic
1193854355 X:86580402-86580424 CAGAAATAGAATTCAGAATATGG + Intronic
1193859054 X:86641118-86641140 CAGAAATAGAATTCAGAATATGG + Intronic
1193932191 X:87567057-87567079 TTAAAATAGAAGTTAAAAAAAGG + Intronic
1193996910 X:88376330-88376352 GAAAAATAGAAGACAAAAAACGG + Intergenic
1194038664 X:88913504-88913526 ATAAAGTAGAACTGAGAAAAAGG + Intergenic
1194085624 X:89524456-89524478 CAGAAATATAATTCAGAAAATGG - Intergenic
1194099638 X:89687981-89688003 CTAAAATAAAAATGAAAAAAAGG - Intergenic
1194139334 X:90190604-90190626 CTCAAAAAGAAGAAAGAAAAAGG + Intergenic
1194180441 X:90704980-90705002 CCAAAAAAGGAGTCAGCAAAGGG - Intergenic
1194217318 X:91147318-91147340 CAGAAATAGAAATCAGAAAATGG - Intergenic
1194304579 X:92227278-92227300 AAAAAATAGAAAACAGAAAAAGG - Intronic
1194512198 X:94810854-94810876 CACAAATAGAATTCAGAATATGG - Intergenic
1194519429 X:94900856-94900878 CATAAATAGAATTCAGAATATGG - Intergenic
1194540012 X:95157974-95157996 CATAAATAGAATTCAGAATATGG + Intergenic
1194632083 X:96297055-96297077 CAGAAATAGAATTCAGAATATGG + Intergenic
1194646815 X:96468021-96468043 CTAAAATAGAAGAAAGACAATGG - Intergenic
1194664006 X:96656852-96656874 CAGAAATAGAATTCAGAATATGG + Intergenic
1194740846 X:97572649-97572671 GAAAAAGAAAAGTCAGAAAATGG - Intronic
1194809411 X:98372507-98372529 CTATTATACCAGTCAGAAAAAGG - Intergenic
1194982115 X:100451178-100451200 CAGAAATAGAATTCAGAATATGG + Intergenic
1195241605 X:102958616-102958638 CAAAAATAGAATTCAGAATATGG - Intergenic
1195473382 X:105258902-105258924 CAGAAATAGAATTCAGAATATGG - Intronic
1195567723 X:106362558-106362580 CAGAAATAGAATTCAGAATATGG - Intergenic
1195574574 X:106435611-106435633 CTAAAATAGAATTCAGAGAAAGG + Intergenic
1195676425 X:107510641-107510663 CTTAAACAGTGGTCAGAAAAGGG - Intergenic
1195742036 X:108074631-108074653 CTATAATAGAAGTCTGAACAGGG + Intronic
1195879388 X:109576499-109576521 CTGAAAAAGGAGTCAGCAAAGGG - Intergenic
1196222013 X:113122490-113122512 CTGAAAAAGGAGTCAGCAAAGGG + Intergenic
1196356882 X:114805423-114805445 TTAAAATTGAAGTCAGGAAATGG - Intronic
1196496584 X:116330465-116330487 CTGACATAGAAGTCAGAATCTGG + Intergenic
1196970612 X:121104361-121104383 CTATAATAAAAGTCAAAATAGGG + Intergenic
1197092954 X:122559974-122559996 CAGAAATAGAATTCAGAATATGG + Intergenic
1197094977 X:122583185-122583207 CTGAAACAGAAGTCAGAGCAGGG + Intergenic
1197187998 X:123609707-123609729 CTAACATGGAAGCAAGAAAACGG + Intronic
1197249666 X:124201817-124201839 ATAAAAAAAAAGTCAGAATAAGG + Intronic
1197368281 X:125594362-125594384 CTAAAATAGATGGTAGAAAAGGG + Intergenic
1197386246 X:125806406-125806428 ATATAATAGAAGTATGAAAAGGG + Intergenic
1197482613 X:127005520-127005542 CATAAATAGAATTCAGAATATGG + Intergenic
1197582405 X:128299570-128299592 CAAATATAGAATTCAGAATATGG + Intergenic
1198447096 X:136728047-136728069 AAAAAGTAAAAGTCAGAAAAAGG - Intronic
1198983998 X:142428638-142428660 CGAAAAGAGAAGTCAGTGAAGGG + Intergenic
1198995801 X:142572272-142572294 CAGAAATAGAATTCAGAATATGG + Intergenic
1199108995 X:143907978-143908000 TTAAAATACAAGTTAAAAAAAGG + Intergenic
1199428932 X:147736516-147736538 CTAAAATAAAAGTTAAAAAAAGG - Intergenic
1199443135 X:147891155-147891177 CCAAAGTAGAAGTTAGAAAAAGG - Intergenic
1199525059 X:148782957-148782979 CTAAAGTATAAATCAGGAAAAGG + Intronic
1199525104 X:148783464-148783486 CTAAAATACAAGTCAGGAAAAGG - Intronic
1199707035 X:150436696-150436718 CAGAAATAGAATTCAGAATATGG - Intronic
1200438268 Y:3180338-3180360 CAGAAATATAATTCAGAAAATGG - Intergenic
1200452642 Y:3349361-3349383 CTAAAATAAAAATGAAAAAAAGG - Intergenic
1200527106 Y:4287139-4287161 CCAAAAAAGGAGTCAGCAAAGGG - Intergenic
1200612838 Y:5344652-5344674 ATAAAAGAAAAGTTAGAAAATGG - Intronic
1201262546 Y:12174323-12174345 CTAAAAAAAAAGAAAGAAAAGGG + Intergenic
1201362186 Y:13164582-13164604 CTAAAAAAGGAGTCAGCAAAGGG + Intergenic
1201365856 Y:13205499-13205521 CTGAAAAAAGAGTCAGAAAAGGG + Intergenic
1201484245 Y:14475353-14475375 CTGAAAAAGGAGTCAGCAAAGGG + Intergenic
1201538681 Y:15082297-15082319 CTAAAATAAAAGTTGGAAAGAGG - Intergenic
1201646743 Y:16241796-16241818 ATAAATAAGAAGTCAGAAAACGG + Intergenic
1201656070 Y:16343521-16343543 ATAAATAAGAAGTCAGAAAACGG - Intergenic
1201891099 Y:18945015-18945037 CCAAAAAAGTAGTCAGCAAAGGG + Intergenic