ID: 1009918064

View in Genome Browser
Species Human (GRCh38)
Location 6:70021179-70021201
Sequence TTCCTAGCAAAACTCCGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009918064 Original CRISPR TTCCTAGCAAAACTCCGCAA TGG (reversed) Intronic
903740100 1:25553823-25553845 TTCCTAGGAAACCCCAGCAAGGG - Intronic
904766256 1:32850272-32850294 TTCCTACCAAAGCTTCACAAAGG - Intronic
909379638 1:74983770-74983792 TTCCTAGTAAAACACAGAAAAGG - Intergenic
911028814 1:93464114-93464136 TTCCTACCAAAAGTGCACAAGGG - Intronic
920025288 1:202989501-202989523 TTCCTTCAAAAACTCTGCAAAGG - Intergenic
922449513 1:225725508-225725530 TTCTTATCAAAACTCTGCAATGG - Intergenic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1073554719 10:104438273-104438295 TGCCTAACAACACTCAGCAATGG + Intronic
1074770860 10:116732837-116732859 TTTCCAGCTGAACTCCGCAATGG - Intronic
1078346198 11:10551392-10551414 TTCCTAGCAAACCTCCCCTTTGG - Intergenic
1081026360 11:38019579-38019601 TGCCTACCAAGACTCTGCAATGG - Intergenic
1087517940 11:99189493-99189515 TTCCTACCAACACTATGCAAAGG + Intronic
1090441165 11:126726749-126726771 CTCCTAGCAAAACTCTGTATTGG + Intronic
1090522150 11:127490735-127490757 TTCCTACCTAAACTACTCAAAGG + Intergenic
1097530710 12:60796346-60796368 TTTCTTGCAAAACTGGGCAATGG + Intergenic
1098556952 12:71829859-71829881 TTCCCAGCAACACTGCCCAAGGG + Intergenic
1099378441 12:81923572-81923594 TTCCCATCAAAAATGCGCAAGGG + Intergenic
1105388204 13:19951768-19951790 TTCCTAGCAACAGTGTGCAAGGG - Intergenic
1108079847 13:46723829-46723851 TTCCTCACAAAACTCCACTAAGG - Intronic
1112072723 13:95872942-95872964 TCCTTAGCAAAACCCCACAAGGG + Intronic
1116023041 14:39484563-39484585 TTCCTATCAAAATTGGGCAAAGG + Intergenic
1120058669 14:79955530-79955552 TGCCTTGCAAAACTCCTGAAGGG + Intergenic
1131764736 15:95663235-95663257 TTAATAGCAGAACTCCCCAAAGG + Intergenic
1135802117 16:25507092-25507114 TTCCTAACATAACTAGGCAATGG + Intergenic
1136295515 16:29299344-29299366 TTCCTAGCATAACACCACACAGG - Intergenic
1136592685 16:31226890-31226912 TCCCGAGAAAACCTCCGCAATGG - Intergenic
1142588941 17:992500-992522 TTACTAGCAAAAGTTCACAAGGG + Intergenic
1151349224 17:73521823-73521845 ATCCTAACAAAACCCAGCAAGGG - Intronic
1155974688 18:32116429-32116451 TTGCAATCAGAACTCCGCAAAGG - Intronic
1156166018 18:34421982-34422004 TTCTTACCAAAACTCCACGAGGG + Intergenic
1156635453 18:39022703-39022725 TTCATAGCAAAAGTCAGGAAAGG - Intergenic
1159230592 18:65603707-65603729 TTTATAGCAAAACTCCTCACAGG + Intergenic
1159435976 18:68417790-68417812 TTCCTGGGAAAAATCAGCAAGGG - Intergenic
1160205216 18:76826046-76826068 TTCCTAAGAAAACTCTGCAAGGG + Intronic
1164419127 19:28072314-28072336 TATCTTGCAAAACTCAGCAAGGG - Intergenic
925105906 2:1290948-1290970 TTCCTAGCAATAGTACACAAGGG + Intronic
934489899 2:94755353-94755375 TTACTAGCAAAACCCTGCAGAGG + Intergenic
940313013 2:152298289-152298311 TTCACAGCAAAACTGAGCAAAGG + Intergenic
941140661 2:161776802-161776824 TTCCCAACAAAAATGCGCAAGGG + Intronic
1169967142 20:11230303-11230325 TTTCTAGCAAAACTGCACAACGG + Intergenic
1175424946 20:58857599-58857621 TTCCTAGCAGATCTCCACTAAGG + Intronic
1177466598 21:21491344-21491366 TTGCTAGCAAAAGTCCATAAAGG + Intronic
1184958421 22:47909093-47909115 TTCCTATCAAAACTCTGTGAAGG - Intergenic
953487258 3:43313004-43313026 TTCCTATCAAAACTCTGCAGGGG + Intronic
956209658 3:66789859-66789881 TTCCTTGCAGAACTCCCCCATGG + Intergenic
961633477 3:128318266-128318288 GTCCCAGCAAAACTTTGCAAAGG - Intronic
961650621 3:128415108-128415130 TTCCAAGCCAAATTCCCCAAGGG - Intergenic
962391981 3:134980023-134980045 TGCATAGCAAAACACCTCAATGG + Intronic
962748030 3:138412003-138412025 TCCCCAGCAAAACTCAGGAATGG - Intergenic
962843716 3:139257455-139257477 TTCCCAGCAAAAATGCACAATGG + Intronic
970267488 4:14305122-14305144 TTCCTACCAAAAATATGCAAGGG - Intergenic
973247008 4:48019751-48019773 CTCCTTCCAAAACTCCACAAGGG - Intronic
976777256 4:88720245-88720267 TCCCTATCAATACTCCACAAAGG - Intergenic
979779352 4:124630954-124630976 TTCCTACCAAAAATGCACAAGGG + Intergenic
985332038 4:188848395-188848417 TTCCTACCAAAAATACACAAGGG + Intergenic
986272232 5:6243348-6243370 CTCCAAGCAAAATTCAGCAAAGG - Intergenic
986307904 5:6529092-6529114 TTTCTAGCAAAAATCCCAAATGG - Intergenic
987059408 5:14227599-14227621 TTCCTAACCAAATTCCTCAAAGG - Intronic
990200124 5:53362568-53362590 TTCCTGGCCAAACTCAACAAAGG + Intergenic
990601172 5:57360006-57360028 TTTGGAGCAAAACTCCTCAAAGG - Intergenic
994915941 5:105979020-105979042 TTCATAGGAAAACTCCACAGAGG + Intergenic
1000913724 5:167053913-167053935 TTCATAGCAAAATTGAGCAAAGG + Intergenic
1009918064 6:70021179-70021201 TTCCTAGCAAAACTCCGCAATGG - Intronic
1014252930 6:119133351-119133373 TCCCTAGGAAGACTCCGAAATGG + Intronic
1014841678 6:126227181-126227203 TAACTAGCAAAACCCCACAAAGG + Intergenic
1015955408 6:138592981-138593003 TTCCTAGCCAAACTCTGTCATGG + Intronic
1019407569 7:891734-891756 CTCCTGGCAAAGCTCCGCAGCGG - Intronic
1025062100 7:55819124-55819146 TACCTTGCAAAACTCCCCAAGGG + Exonic
1025617793 7:63138888-63138910 TACCTTGCAAAACTCCCCAAGGG + Intergenic
1032521545 7:132549385-132549407 TTCCTACCAAGACACCTCAAGGG - Intronic
1035560743 8:601927-601949 TTCCTAGTAAACCTCCTCATTGG - Intergenic
1036083444 8:5585064-5585086 TTCCCAGTAAAAATCTGCAAAGG + Intergenic
1038646846 8:29369127-29369149 TTCCGTGCAAAACTCTCCAAAGG - Intergenic
1041665181 8:60437392-60437414 TTCCTAACTAATCTCAGCAAAGG + Intergenic
1041687618 8:60658741-60658763 CACCTAGCAAAACTCTGCTATGG + Intergenic
1044578750 8:93800906-93800928 TTTCAAGAAAAACTCCACAAGGG - Intronic
1046541978 8:115597138-115597160 TTCCTAGCAAACCTATGAAAAGG + Intronic
1050884149 9:10742769-10742791 TTCCTTGAAAAAGTCAGCAAAGG + Intergenic
1052811580 9:33065621-33065643 TACCTTGCAAAACTCCAAAAAGG + Intronic
1053667894 9:40329172-40329194 TTACTAGCAAAACCCTGCAGAGG - Exonic
1053917699 9:42955459-42955481 TTACTAGCAAAACCCTGCAGAGG - Intergenic
1054379039 9:64469211-64469233 TTACTAGCAAAACCCTGCAGAGG - Intergenic
1054516717 9:66047111-66047133 TTACTAGCAAAACCCTGCAGAGG + Intergenic
1055688739 9:78807378-78807400 TTCATAGCAAAATTCCACTAAGG - Intergenic
1056936484 9:90919024-90919046 TTTCTAGCACAACTCCTGAAGGG - Intergenic
1058289958 9:103227621-103227643 TTTCTAGCAAAAGTTCACAAAGG - Intergenic
1187258744 X:17665873-17665895 TTCCTTGAAAAACTTAGCAAGGG - Intronic
1187893151 X:23956044-23956066 ATCCTAGCAAAAGTCAGAAAAGG - Intergenic
1188678513 X:32972974-32972996 ATCCTATCAAATCTCCACAAAGG - Intronic
1195759693 X:108233153-108233175 TTTCTAGCAAAACACAGCTATGG + Intronic
1196141441 X:112267163-112267185 TTCTTAACAAAACTCCTCAAAGG + Intergenic
1196352920 X:114754251-114754273 TTCCTACCAAAACTCCAAAAAGG + Intronic
1197657413 X:129132130-129132152 TTCTTATCAAAATTCTGCAATGG - Intergenic
1197948547 X:131868948-131868970 TTCCTACCAAAAGTGCACAAGGG - Intergenic
1198946587 X:142022753-142022775 TTCCTACCAAGAGTCTGCAAGGG + Intergenic