ID: 1009918612

View in Genome Browser
Species Human (GRCh38)
Location 6:70028156-70028178
Sequence TATATTAACGTGCATACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 97}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009918612 Original CRISPR TATATTAACGTGCATACAGT GGG Intronic
900781449 1:4620786-4620808 AATATTTATATGCATACAGTTGG - Intergenic
901327049 1:8373222-8373244 TATTTTAACATGAATACAGAAGG + Intronic
905984288 1:42263970-42263992 TATATTAACTTTCACATAGTAGG - Intronic
909932748 1:81516920-81516942 CACACTAACTTGCATACAGTGGG + Intronic
912065615 1:105737353-105737375 TATATTAACATAAATACAGATGG - Intergenic
912917520 1:113830996-113831018 TAAAATAACTGGCATACAGTAGG + Intronic
916352315 1:163864746-163864768 CATCTTAAAGTGCATTCAGTGGG + Intergenic
919414240 1:197287276-197287298 TATATTAGCCTGGTTACAGTAGG - Intronic
1063732382 10:8712695-8712717 TATGTTAATGTGAATAGAGTGGG + Intergenic
1066794976 10:39110124-39110146 TAAATTAACGTACAAACAGTGGG + Intergenic
1067381553 10:45778295-45778317 CATATTACCTTGCACACAGTAGG + Intronic
1067889252 10:50118929-50118951 CATATTACCTTGCACACAGTAGG + Intronic
1067966189 10:50915602-50915624 CATATTAACGTATATATAGTAGG + Intergenic
1068547222 10:58361043-58361065 TAAATTATCTTACATACAGTAGG + Intronic
1069768244 10:70879718-70879740 TAAATTAAAGTGGCTACAGTAGG - Exonic
1071235070 10:83635963-83635985 TATGTGTACGTGAATACAGTTGG + Intergenic
1072307222 10:94119355-94119377 TATATGGACATGCATACAGCTGG - Intronic
1074674528 10:115833165-115833187 TATATTGTATTGCATACAGTAGG - Intronic
1075864874 10:125709152-125709174 TATTTTAACGTGCATACCATGGG - Intergenic
1075866255 10:125721930-125721952 TGTATTAATGTACATACTGTAGG + Intronic
1075927148 10:126260871-126260893 TATATTTATGTCCATACAATTGG + Intronic
1078084696 11:8226769-8226791 AATATTAAAGTGCACACATTTGG + Intronic
1081078021 11:38699857-38699879 AATATTAACATGCTTAGAGTCGG + Intergenic
1083973870 11:66101346-66101368 TATATACACATACATACAGTGGG + Intronic
1088128219 11:106454966-106454988 TATATTAACATGCAAACAAATGG - Intergenic
1095609963 12:44116031-44116053 AATACTAACGTGCAGTCAGTTGG - Intronic
1098176344 12:67795530-67795552 TATAGTACCTTGCATTCAGTAGG - Intergenic
1100446191 12:94662215-94662237 CATATTAACGTTCATAGATTTGG + Intergenic
1103752814 12:123177767-123177789 TATATAACCATGCATACAATAGG + Intronic
1104148490 12:126058480-126058502 TATATTAAGATGCTTACATTAGG - Intergenic
1106857822 13:33872011-33872033 TTTATTAACGTTCAGACAGGAGG + Intronic
1108124424 13:47225626-47225648 TATACCAACATGCACACAGTGGG - Intergenic
1113277924 13:108753790-108753812 TACATTAACTTGCACAAAGTAGG + Intronic
1118429506 14:65702427-65702449 TATAGTACCGCGCATACAGTTGG + Intronic
1120545230 14:85803165-85803187 TGCATTAACGTGTTTACAGTTGG + Intergenic
1120725623 14:87936635-87936657 CTTAGTAAAGTGCATACAGTAGG + Intronic
1121184981 14:91958972-91958994 TAGATTAATTTACATACAGTTGG + Intergenic
1125083638 15:35704648-35704670 TATGATAATGTGCACACAGTGGG - Intergenic
1126992596 15:54398859-54398881 TTTATAAACGTTCAGACAGTTGG - Intronic
1130565967 15:84995614-84995636 TATATAAAAGTACATACACTGGG - Intronic
1133844629 16:9442468-9442490 TATTTTAACATGCATAGTGTGGG - Intergenic
1135792104 16:25406452-25406474 CATATTTATCTGCATACAGTAGG + Intergenic
1138897166 16:61221017-61221039 TATATTTACCTGAATACAATGGG + Intergenic
1143993152 17:10984150-10984172 TATATTGAAGTGCATAAATTAGG - Intergenic
1146497538 17:33336526-33336548 TAAATTACCTTGCATACAGTAGG - Intronic
1149202601 17:54204930-54204952 TATATTAACTTACAAATAGTAGG - Intergenic
1153967862 18:10197833-10197855 TATATTTAGGGACATACAGTAGG - Intergenic
1159258343 18:65977546-65977568 TATATTCGCTTGCCTACAGTAGG - Intergenic
1159408003 18:68031448-68031470 TATACTAATGTACATATAGTAGG + Intergenic
1165276112 19:34753014-34753036 GTTATTAATGTACATACAGTAGG - Intergenic
925522784 2:4766268-4766290 TATTTTCACGTGCAGACTGTTGG + Intergenic
927693485 2:25224365-25224387 TATAGTAGTGTGCATATAGTAGG - Intergenic
928634572 2:33230311-33230333 CAAATTAACATGTATACAGTTGG - Intronic
928635699 2:33243865-33243887 TATATTTACAAGCATTCAGTTGG - Intronic
933028549 2:77295246-77295268 TATATTATATTGGATACAGTAGG + Intronic
933295035 2:80480126-80480148 TATATTAACATGCAAATAATGGG - Intronic
936370787 2:111900253-111900275 TAATTTAACGTGCAAAAAGTGGG - Intronic
938580189 2:132638815-132638837 TAAATTAACTTGCATGTAGTAGG - Intronic
939178114 2:138773835-138773857 GACATTTACGTGCTTACAGTTGG + Intronic
941768078 2:169320102-169320124 TTTATTAAAGTTCTTACAGTTGG - Intronic
942159578 2:173169025-173169047 TATAGTACCTTGCATACAGAAGG + Intronic
948046001 2:234945856-234945878 AATATTAACGTGCAGACAACTGG + Intergenic
1171322630 20:24259805-24259827 TATATTATAGTCCATACAGTGGG + Intergenic
1177596743 21:23253674-23253696 TATATTAATGTGCAATGAGTAGG - Intergenic
1180582225 22:16849368-16849390 TAAATAAACATGCATACATTAGG + Intergenic
951768247 3:26224853-26224875 TATTTTAACGTGCATAGTATGGG - Intergenic
956419966 3:69077190-69077212 TAAATTAACGTGCAAACTCTTGG - Intronic
958502748 3:94935995-94936017 TAAATGAAGGTGCATACACTGGG + Intergenic
967531684 3:190554843-190554865 TCTATTAAAGTGTATAAAGTAGG + Intronic
979447314 4:120829555-120829577 TATATTTATTTGCACACAGTGGG - Intronic
983611101 4:169646169-169646191 TATATTGGCATGCATAGAGTAGG + Intronic
983781712 4:171676948-171676970 TGTATTAACGTTCATGCTGTAGG + Intergenic
983830248 4:172318144-172318166 TGTATTACTGTGCATACAATTGG - Intronic
984571444 4:181399169-181399191 AATAGTAAAGTGCATACAATAGG - Intergenic
988579575 5:32457220-32457242 TATATTAATGTGCAAACATAAGG + Intergenic
988701942 5:33684371-33684393 TATATTGCCTTGCACACAGTAGG - Intronic
990470852 5:56114026-56114048 TATATTAAAATGAATAAAGTGGG + Intronic
991066870 5:62433392-62433414 TATACGAACGTGCCTACAGTTGG - Intronic
993919849 5:93788150-93788172 AATATGAACTTGCATACAGATGG - Intronic
994744190 5:103658505-103658527 TATAGTAACTGGCACACAGTAGG - Intergenic
996277294 5:121682282-121682304 CATATTAAAGTGCTTTCAGTGGG - Intergenic
999694320 5:154175309-154175331 TATATGAACATGCATTCAGTAGG + Intronic
1000288116 5:159845582-159845604 TATATATATGTGCATACACTGGG - Intergenic
1001610362 5:172996137-172996159 TTTATTAACGGGCATGCAGTGGG - Intronic
1003650711 6:7957711-7957733 TATAATAACGTGGATAAACTTGG + Intronic
1004568254 6:16819929-16819951 AATATTAGCTTGCATCCAGTAGG - Intergenic
1005219935 6:23574857-23574879 AATATTAACCTGAAGACAGTGGG + Intergenic
1009918612 6:70028156-70028178 TATATTAACGTGCATACAGTGGG + Intronic
1011524150 6:88245048-88245070 TATTTTAATTTCCATACAGTAGG - Intergenic
1013582452 6:111549843-111549865 CATATTACCTTGCACACAGTAGG + Intergenic
1014783091 6:125587211-125587233 TATATAAATGTTCATACATTTGG - Intergenic
1016513703 6:144870962-144870984 TATATTAACATGCATAGGGGAGG - Intergenic
1018194605 6:161344091-161344113 TAAATTAATTAGCATACAGTAGG + Intergenic
1021588211 7:22232738-22232760 TATAATGCTGTGCATACAGTAGG + Intronic
1022252635 7:28623864-28623886 AATATTAACGTTCATAAAGATGG + Intronic
1025603642 7:63023316-63023338 TGTTTTAATGTGCATCCAGTTGG + Intergenic
1031800414 7:126236686-126236708 TATATTAATTTGTATACATTTGG - Intergenic
1034231793 7:149535342-149535364 TCTATGAACATGCACACAGTGGG + Intergenic
1038022939 8:23565155-23565177 TAGATTAACCTGTATACTGTGGG - Intronic
1043014616 8:74922477-74922499 TATAATACCCTGCACACAGTAGG - Intergenic
1050789058 9:9442951-9442973 TATATGTACGTGCATACATATGG - Intronic
1060713882 9:125901530-125901552 TATAGTACTGTGCATATAGTGGG + Intronic
1061629816 9:131865021-131865043 GATATTACCCTGCATACAGCAGG + Intronic
1185816651 X:3162725-3162747 TATACTATCATACATACAGTAGG + Intergenic
1197495044 X:127169477-127169499 TATGTTAATGTGAATGCAGTAGG - Intergenic
1198693995 X:139316185-139316207 TGTAGGAATGTGCATACAGTTGG - Intergenic