ID: 1009918828

View in Genome Browser
Species Human (GRCh38)
Location 6:70030900-70030922
Sequence GGGGCTATGACAGCTTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009918828 Original CRISPR GGGGCTATGACAGCTTTTCC AGG (reversed) Intronic
900440954 1:2654994-2655016 GGGGTTGTGAGAGCTGTTCCAGG - Intronic
900495892 1:2975942-2975964 GGAGCAATGACAGATTTTCAAGG - Intergenic
901951797 1:12755495-12755517 GAGCCAATGACAGCTCTTCCCGG + Intronic
902289720 1:15428192-15428214 GGCCTTATGACTGCTTTTCCTGG - Intronic
903331011 1:22597346-22597368 GGGGCTCTGGGAGCTTTCCCGGG - Exonic
912927263 1:113924303-113924325 GGGGCCAGAACAACTTTTCCTGG + Intergenic
914622324 1:149422506-149422528 GGGTCTCTGACAGCTTCTTCAGG + Intergenic
915167199 1:153954724-153954746 GGGGCTATGGTCGCTTTTCAGGG + Intronic
915599195 1:156912197-156912219 GGGGCAGGTACAGCTTTTCCTGG - Intronic
920204806 1:204283683-204283705 GGGGAGATGCCAGCTTTTCAAGG + Intronic
920573273 1:207034323-207034345 CGGGCTATGACCTCTTTCCCTGG + Intronic
921308847 1:213823173-213823195 TGGTCTATGAAAGCTTTTCCAGG - Intergenic
923935296 1:238753282-238753304 TGGGCTATGTCAGCTTTATCAGG + Intergenic
924384152 1:243487330-243487352 GGGGCTGAGGCAGCCTTTCCTGG - Intronic
1067760304 10:49039941-49039963 GAAGTAATGACAGCTTTTCCTGG + Intronic
1067802476 10:49368545-49368567 TGGGAGATGACAGCTTTTGCTGG + Intronic
1068437996 10:57016341-57016363 GAGGCTGAGACAGCCTTTCCTGG + Intergenic
1068616331 10:59122018-59122040 GGAGCTGGGACAGCTTTTCAGGG + Intergenic
1069996143 10:72343280-72343302 GGGACCAAGACAGCTTTCCCAGG - Intronic
1071339178 10:84626930-84626952 GGGTCTATGGCTGCTCTTCCTGG + Intergenic
1081331241 11:41802852-41802874 GAGGCTCAGAAAGCTTTTCCTGG + Intergenic
1081481392 11:43492838-43492860 TGGGTTATGACAGCTTTTAGGGG - Intronic
1082029509 11:47594284-47594306 GGGGCTCCGGCTGCTTTTCCCGG + Exonic
1083076485 11:60044253-60044275 GGTGCTTTACCAGCTTTTCCAGG + Intronic
1083596999 11:63922728-63922750 TGGGCTGTGAGACCTTTTCCTGG - Intergenic
1086378223 11:86223235-86223257 GTGGCTAGGAGAGATTTTCCTGG + Intergenic
1088233741 11:107700615-107700637 GGTGCAAGGAAAGCTTTTCCTGG + Intergenic
1088257576 11:107915770-107915792 GGGGCTGGGACAGGTTTTACAGG - Intronic
1089400340 11:118160835-118160857 GGGGCCTTGACAGGTATTCCTGG + Intergenic
1089501324 11:118933182-118933204 CTGCCTATGACAGCTTCTCCTGG - Intronic
1091129450 11:133133338-133133360 GGAGCCAAGGCAGCTTTTCCTGG - Intronic
1096215201 12:49794667-49794689 GGAGCTAGGCCTGCTTTTCCTGG - Intronic
1107374152 13:39784136-39784158 AAGGTGATGACAGCTTTTCCAGG - Intronic
1107912575 13:45119251-45119273 AGAGTTCTGACAGCTTTTCCTGG + Intergenic
1108203170 13:48061900-48061922 GGGGATATGACAGCTTAGCTTGG - Intronic
1109567054 13:64131486-64131508 GGGGCCATGACAACTTTACTGGG - Intergenic
1110289928 13:73793553-73793575 GGAGCTATGAATGCATTTCCTGG + Intronic
1110555879 13:76858432-76858454 GGCTCTGTGACAGCTTTTTCTGG + Intergenic
1112444324 13:99450360-99450382 GGGAATCTGACAGATTTTCCTGG - Intergenic
1112953862 13:105035474-105035496 GGGCCTATGGCATCATTTCCTGG + Intergenic
1118050346 14:62019797-62019819 CGGGCACTGACCGCTTTTCCTGG + Intronic
1129198418 15:73984509-73984531 GGGGCTCAGACACCATTTCCAGG - Intronic
1129997925 15:80022941-80022963 GGGGGTAGAACAACTTTTCCAGG - Intergenic
1132560454 16:590958-590980 GGGACCATGACATCTTTCCCCGG - Intronic
1134216688 16:12321867-12321889 GGGGATATCACAGCTGTGCCAGG + Intronic
1135930313 16:26730698-26730720 GGAGGGATGACAGCTTTTCCTGG - Intergenic
1138925516 16:61585461-61585483 AGGCCAATGACAGCTTTTCTTGG - Intergenic
1140477321 16:75245421-75245443 GGGCCTCTGCCAGCCTTTCCTGG - Intronic
1141922256 16:87143957-87143979 GGGTCTGTGCCAGCTGTTCCTGG + Intronic
1143515422 17:7417270-7417292 GGGCCTATGACCGCTTCCCCGGG + Exonic
1145282425 17:21477758-21477780 GGTGCTGGGACAGCATTTCCTGG + Intergenic
1145395047 17:22487997-22488019 GGTGCTGGGACAGCATTTCCTGG - Intergenic
1146630907 17:34468714-34468736 GGGGCTAAGAGAGCTTTGCTGGG - Intergenic
1147480923 17:40762122-40762144 GGGGCTGGGACTGCTTTTCAGGG + Intergenic
1147538645 17:41337216-41337238 AGGGCCTGGACAGCTTTTCCTGG - Intergenic
1152273736 17:79341654-79341676 GGGGCAGTGACTGCTTCTCCAGG - Intronic
1153757400 18:8298255-8298277 ATGGCTATGACATCCTTTCCAGG + Intronic
1154404697 18:14078582-14078604 GGTGATATGACAGCTTTGCCTGG + Intronic
1156264971 18:35479831-35479853 GGGGCTTTCTCAACTTTTCCAGG - Intronic
1156938258 18:42737062-42737084 GGGGATATGACAGCTTCGCTTGG - Intergenic
1166633641 19:44430109-44430131 GGGATGATGACAGCTTTTGCTGG - Exonic
925450455 2:3965027-3965049 GGGGCTGTGCCAGCTGGTCCAGG + Intergenic
925530392 2:4853538-4853560 CTGTCTATGACAGCTTGTCCTGG + Intergenic
926043395 2:9692492-9692514 GGGCCTAGGGCAGCTTTGCCAGG - Intergenic
926070342 2:9883788-9883810 GGGGCTCTATCAGCTTTGCCAGG - Intronic
927406654 2:22777954-22777976 TGGTCTATTACATCTTTTCCAGG - Intergenic
930342678 2:50136581-50136603 GGGTCCATGACACCTTTTCTAGG - Intronic
931276090 2:60745173-60745195 GAGGCTGAGACAGCTTTTCTGGG - Intergenic
932379324 2:71268049-71268071 GGGGATATGATAGCCTTTCTAGG + Intergenic
932714667 2:74092688-74092710 GTGGCTTCCACAGCTTTTCCTGG + Intronic
935273005 2:101451141-101451163 GGGACTATAGCAGCTTGTCCCGG + Intronic
937441469 2:121919586-121919608 AGAGCTATGAAAGCTCTTCCAGG - Intergenic
939007897 2:136810186-136810208 TGGCCCATGAAAGCTTTTCCTGG + Intronic
945627552 2:212229670-212229692 AGGGCTGTTACAGCTTATCCAGG + Intronic
946117815 2:217479009-217479031 GGGAGTGTGACAGCTTTTTCAGG + Intronic
1169250880 20:4060468-4060490 GGGGCCATCACAGCCTTTCGTGG + Intergenic
1170957292 20:20992810-20992832 TGGGCTAGGAAGGCTTTTCCTGG + Intergenic
1171494353 20:25545050-25545072 GGAGCTATCCCAGGTTTTCCTGG - Intronic
1174190724 20:48738593-48738615 GGGGCTCTGATTGCTTTGCCAGG + Intronic
1174430665 20:50466238-50466260 GGGGCTATGACATGTTGTCCAGG - Intergenic
1176163602 20:63661420-63661442 GGCGCAAGGAGAGCTTTTCCCGG + Exonic
1176384679 21:6133434-6133456 GTGGCAATGACAGCTTCTCTAGG + Intergenic
1178538637 21:33430977-33430999 GGGACAATGACAGCCTTGCCAGG + Intronic
1178588936 21:33893053-33893075 GGGCCTAAGACTGCTTCTCCTGG - Exonic
1179738793 21:43404818-43404840 GTGGCAATGACAGCTTCTCTAGG - Intergenic
1181013091 22:20053638-20053660 GGGGCTGTGGCAGCCTCTCCAGG + Intronic
1181442012 22:22941617-22941639 GGGGCTGGGAGAGCTATTCCAGG + Intergenic
1183375820 22:37464421-37464443 GGGGCCAGGACAGCTGTGCCTGG + Intergenic
1184028898 22:41879343-41879365 GGGCCTCTTCCAGCTTTTCCAGG - Intronic
1184057479 22:42062171-42062193 TTGGCTATAACAGCTTCTCCTGG + Intronic
949308841 3:2673306-2673328 GGGTCTAAGCCAGCTTCTCCTGG + Intronic
949524692 3:4891587-4891609 CAGGCTATGACTGCTTTGCCAGG + Intergenic
950853699 3:16086510-16086532 GGGACTATTACAGCTTCCCCTGG - Intergenic
952504484 3:33995613-33995635 TGAGCGATTACAGCTTTTCCAGG + Intergenic
953542594 3:43835353-43835375 GGGGCTAAGGCAGCATTTCAAGG + Intergenic
958584390 3:96068548-96068570 AGGGCTATGACACCTTTTTTGGG - Intergenic
962200315 3:133395860-133395882 GGGGCTCTGAGAGCTGGTCCTGG - Exonic
972707981 4:41564324-41564346 GAGGCTATTTCAGGTTTTCCTGG + Intronic
976213932 4:82698034-82698056 GATGCCCTGACAGCTTTTCCTGG - Intronic
976992727 4:91388220-91388242 GAGGTTATGGCAGCTTTTCTTGG - Intronic
981986615 4:150864616-150864638 GGGCCCATGAGAGCTTTTCATGG - Intronic
990290019 5:54340588-54340610 GGGGCTATGACTGCTATTCTAGG - Intergenic
990996850 5:61740998-61741020 GGGGCTCTGACACCTTTGCTGGG - Intronic
991776642 5:70091672-70091694 GGGGCAAGGGCTGCTTTTCCTGG + Intergenic
991855929 5:70967119-70967141 GGGGCAAGGGCTGCTTTTCCTGG + Intergenic
991869944 5:71099892-71099914 GGGGCAAGGGCTGCTTTTCCTGG + Intergenic
993953669 5:94205726-94205748 GGGTCTATGGCAACATTTCCAGG - Intronic
993967355 5:94373983-94374005 GGGCCTATGACAGCTACTCCTGG + Intronic
994434040 5:99706172-99706194 GCGGGTATGACAGCCTTTCTGGG - Intergenic
995537687 5:113153515-113153537 GGGCATCTGACAGCTCTTCCTGG - Intronic
999399550 5:151253718-151253740 GAGGGTTTGAGAGCTTTTCCAGG + Intronic
1002306718 5:178287836-178287858 GGGGCTAGGACATCTATCCCAGG + Intronic
1003833870 6:10045609-10045631 GAGGCTATCACAGTTTTTCAAGG + Intronic
1006458461 6:34144866-34144888 GGGGCTAAGGCAGGCTTTCCGGG - Intronic
1009918828 6:70030900-70030922 GGGGCTATGACAGCTTTTCCAGG - Intronic
1012037837 6:94165807-94165829 GGGGCTATGGCAGCTGGTGCTGG - Intergenic
1017120838 6:151022630-151022652 AGGGGGAAGACAGCTTTTCCAGG - Intronic
1017174677 6:151492187-151492209 AGAGCTATGGCAGCTTTTCTTGG - Intergenic
1017754977 6:157521739-157521761 GAGGCTATGACATGGTTTCCTGG + Intronic
1018172440 6:161153123-161153145 GGGCCTGTGCCTGCTTTTCCTGG - Intronic
1023535004 7:41199436-41199458 CAGGCTTTGTCAGCTTTTCCAGG - Intergenic
1028210953 7:88073684-88073706 GGGGCCATGCCAGCTAATCCTGG + Intronic
1028241622 7:88427892-88427914 AAGGCTATGAAAGCTTTTCAGGG + Intergenic
1031976003 7:128093927-128093949 GGGGGCAGGACAGCTTCTCCAGG - Intergenic
1032514259 7:132495186-132495208 GGGGCTAAAACAGCTTTGCTTGG - Intronic
1033190408 7:139273355-139273377 GGTCCTATGACACGTTTTCCTGG - Exonic
1034937728 7:155210530-155210552 GTAGCTGTGACTGCTTTTCCTGG - Intergenic
1039125689 8:34198792-34198814 AGTGTTATGACATCTTTTCCAGG + Intergenic
1041149210 8:54913937-54913959 GGAGCTTTGCCAGATTTTCCTGG + Intergenic
1041492157 8:58445199-58445221 GGGGCTAAGACAGCAATGCCAGG + Intronic
1042600663 8:70496211-70496233 TGGGATATGACAGCTTCTCTTGG - Intergenic
1043721459 8:83550246-83550268 GGGGTTATGACAGCTTAGCTTGG - Intergenic
1046291688 8:112170390-112170412 GGGGCTAGGATAGGTTTTGCAGG - Intergenic
1047939625 8:129816478-129816500 GGGGCTATGTCAGCTGGTGCTGG + Intergenic
1049212831 8:141394627-141394649 GGAGCAATGACAGGTCTTCCTGG + Intronic
1053000739 9:34576095-34576117 GGGGCTTTGAGAGCTCTGCCGGG - Intronic
1055374762 9:75636873-75636895 GGGGTGATGATAGCATTTCCTGG + Intergenic
1055932856 9:81577434-81577456 GAGTCTATGAAAGCTTTTCTAGG + Intergenic
1056201670 9:84282981-84283003 GGAACAAGGACAGCTTTTCCAGG - Intronic
1057219494 9:93248284-93248306 GGGGCTTTCTCAGCATTTCCCGG + Intronic
1059880351 9:118682259-118682281 GGGTCTATGAAATCTTTCCCTGG + Intergenic
1059949107 9:119443296-119443318 GGGGTCATGTCAGCATTTCCAGG + Intergenic
1060243017 9:121920883-121920905 GGGCCTAGGACCGCTTTGCCTGG + Intronic
1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG + Intronic
1188197680 X:27258317-27258339 GGGGTTTTGTCACCTTTTCCAGG + Intergenic