ID: 1009919393

View in Genome Browser
Species Human (GRCh38)
Location 6:70038779-70038801
Sequence TACTGGTTGTTGCACTACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009919389_1009919393 -4 Left 1009919389 6:70038760-70038782 CCCCAAGGGAGTCAGATACTACT 0: 1
1: 0
2: 2
3: 7
4: 95
Right 1009919393 6:70038779-70038801 TACTGGTTGTTGCACTACACTGG 0: 1
1: 0
2: 0
3: 3
4: 54
1009919390_1009919393 -5 Left 1009919390 6:70038761-70038783 CCCAAGGGAGTCAGATACTACTG 0: 1
1: 0
2: 1
3: 12
4: 99
Right 1009919393 6:70038779-70038801 TACTGGTTGTTGCACTACACTGG 0: 1
1: 0
2: 0
3: 3
4: 54
1009919391_1009919393 -6 Left 1009919391 6:70038762-70038784 CCAAGGGAGTCAGATACTACTGG 0: 1
1: 0
2: 1
3: 14
4: 110
Right 1009919393 6:70038779-70038801 TACTGGTTGTTGCACTACACTGG 0: 1
1: 0
2: 0
3: 3
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009919393 Original CRISPR TACTGGTTGTTGCACTACAC TGG Intronic
903701863 1:25254862-25254884 TACTGGTAGTGTCACTACAACGG + Intronic
910272271 1:85409599-85409621 TCCTGCTTGTTGCTCTACACCGG + Intronic
913976971 1:143467496-143467518 TAGCGGTTTTTGCATTACACTGG - Intergenic
914071375 1:144293123-144293145 TAGCGGTTTTTGCATTACACTGG - Intergenic
914107780 1:144673233-144673255 TAGCGGTTTTTGCATTACACTGG + Intergenic
917707717 1:177651104-177651126 TAATGTTTGGTTCACTACACAGG - Intergenic
1066101950 10:32125296-32125318 TGCTGTCTGTTCCACTACACTGG - Intergenic
1067283371 10:44889976-44889998 TAGTGTCTATTGCACTACACAGG + Intergenic
1074994494 10:118744558-118744580 TAGAGGTAGTTGCACAACACTGG + Intronic
1081318275 11:41658970-41658992 TACAGGTTTTGGCACTACACAGG + Intergenic
1084134858 11:67170210-67170232 TACTGGTTGTTCAACTATTCTGG - Intronic
1085072448 11:73559709-73559731 AGATGGTTGTTGCACAACACTGG + Intronic
1093130006 12:15379851-15379873 TAGTGGTGGTTGCACAACCCAGG + Intronic
1096417551 12:51426690-51426712 TCCTTGTTGCTGCACCACACTGG - Intronic
1105222256 13:18342319-18342341 TAGCGGTTTTTGCAATACACTGG + Intergenic
1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG + Intergenic
1111585760 13:90282362-90282384 TTCTGGTTTTTGCAGTACAAGGG + Intergenic
1117807232 14:59507262-59507284 TATTGGATGTTGGAGTACACAGG - Intronic
1118692180 14:68350870-68350892 TACTGGTAGTTCTGCTACACTGG - Intronic
1121383661 14:93497265-93497287 TACAGGGGGTTGCAGTACACAGG + Exonic
1129622226 15:77158509-77158531 TGCTGTATGTTGCACTACAAGGG + Exonic
1139751017 16:69108874-69108896 TACTGGTGGCTGCACTTTACTGG + Intronic
1140388519 16:74564044-74564066 TGCTGGTAGTTCCACTACTCAGG - Intronic
1155559537 18:27061048-27061070 GACTGGTTCTTGACCTACACTGG + Intronic
1165202053 19:34153096-34153118 TACTGGTTCCTGTACAACACAGG + Intergenic
1167675569 19:50882894-50882916 CACTGATTGTTGGACTACAGTGG - Intergenic
934181675 2:89628474-89628496 TAGCGGTTTTTGCATTACACTGG - Intergenic
934291977 2:91702693-91702715 TAGCGGTTTTTGCATTACACTGG - Intergenic
1171496589 20:25560540-25560562 TACTGGCTGTTGCAGCACTCAGG - Intronic
1178162537 21:29936480-29936502 AACTGGTTGTTGATATACACTGG + Intronic
950589865 3:13929497-13929519 TCCTGGGTGTGGCACTATACAGG - Intergenic
952947493 3:38488692-38488714 CACTGGTTTTGGCACTACAGGGG - Exonic
961728106 3:128945941-128945963 AACTGGTACTTGCAGTACACAGG + Exonic
963822809 3:149917366-149917388 TTCTGTTTCTTGCACTGCACGGG + Intronic
964556935 3:157949975-157949997 AACTGGTTGTAGAACCACACAGG - Intergenic
971827934 4:31651698-31651720 GAATTCTTGTTGCACTACACAGG + Intergenic
975015777 4:69417022-69417044 TACTGATTGTTTCATTACCCAGG + Intronic
975604835 4:76144230-76144252 TACTGGTTTTGGCACAACAACGG - Exonic
979115904 4:116822079-116822101 TACTGGATTTTGTACTACAGTGG + Intergenic
1001449572 5:171814037-171814059 GGCTGGTTATTTCACTACACTGG + Intergenic
1004557812 6:16716719-16716741 TAGCAGTTTTTGCACTACACTGG - Intronic
1005940591 6:30556724-30556746 TCCAGGTTGCTGGACTACACCGG + Exonic
1009919393 6:70038779-70038801 TACTGGTTGTTGCACTACACTGG + Intronic
1028283638 7:88966908-88966930 TGCAGCTTGTTGCACTTCACAGG + Intronic
1028476931 7:91264216-91264238 TAGTGGTGGTGGCACTACTCAGG - Intergenic
1028698091 7:93741021-93741043 GACTGGTTCTAGGACTACACAGG - Intronic
1032819036 7:135507761-135507783 TACTTTTTGTTGTAATACACTGG - Intronic
1034598780 7:152226783-152226805 TAGCGGTTTTTGCATTACACTGG - Intronic
1036437516 8:8748841-8748863 AAAGGGTTGTTGCACTACAAGGG - Intergenic
1041841527 8:62277942-62277964 TCCAGGTTCTTGCTCTACACTGG - Intronic
1042202133 8:66289337-66289359 CACTGGTTCTTGTGCTACACAGG + Intergenic
1044334299 8:90960739-90960761 TACTGGTTTTTGCAGTACAATGG + Exonic
1046514892 8:115245765-115245787 GAGAGGTTGTTGCACTAAACGGG - Intergenic
1050376725 9:4982062-4982084 CACAGTTTATTGCACTACACAGG - Intergenic
1057938594 9:99260935-99260957 TACTAGATGTTGCGCTAGACTGG - Intergenic
1193637187 X:83966042-83966064 TACAGGTTATTTCACCACACAGG - Intergenic
1193920765 X:87423205-87423227 TACAGGTTGTTTCATTACCCAGG - Intergenic
1195022158 X:100840028-100840050 TTCTTGGTTTTGCACTACACTGG - Intronic