ID: 1009921801

View in Genome Browser
Species Human (GRCh38)
Location 6:70071726-70071748
Sequence AGGGAGAACAGAATGGCATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 320}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009921796_1009921801 13 Left 1009921796 6:70071690-70071712 CCTAAGCTACAGATGAGAATGTT 0: 1
1: 0
2: 3
3: 23
4: 320
Right 1009921801 6:70071726-70071748 AGGGAGAACAGAATGGCATTGGG 0: 1
1: 0
2: 1
3: 23
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009921801 Original CRISPR AGGGAGAACAGAATGGCATT GGG Intronic
902199856 1:14825202-14825224 AGAGAGAACAGAACAGCTTTTGG + Intronic
902846475 1:19114650-19114672 TGGGAGCAAAGAATGGCATGAGG - Intronic
902989271 1:20174861-20174883 AGGAAGAACTGAACGGGATTTGG - Intronic
903345810 1:22683634-22683656 AGGGAGAACAGCATGGCAGGGGG - Intergenic
903670526 1:25032927-25032949 AGGGAGACCAGAATGTGAATGGG - Intergenic
904019017 1:27447986-27448008 AGGGAGATCAGAATACTATTTGG + Intronic
907087979 1:51695609-51695631 AGCGAAAACAGAATGGGATGGGG + Intronic
907262479 1:53230347-53230369 AGGGAGAACAGAATGGGAGATGG - Intronic
907336985 1:53706253-53706275 AGGGGAATCAGAATGGCATGGGG - Intronic
907512515 1:54972482-54972504 AGTGGGAACACACTGGCATTGGG - Intergenic
907527477 1:55062442-55062464 AGGGAGAACAGCATGTCTCTTGG - Intronic
907663337 1:56413670-56413692 GGGAAGAACAGAATGTTATTAGG - Intergenic
908783136 1:67709691-67709713 TGGGAGCACAGAAAGGGATTGGG - Intronic
908912256 1:69085628-69085650 AGGCAGAACAGCAAGGCATAAGG + Intergenic
909833218 1:80220815-80220837 AGGGAAAAGAAAATGGCTTTGGG - Intergenic
910360404 1:86409997-86410019 TGGCAAAACAGAATGGCCTTAGG - Intergenic
910570743 1:88699660-88699682 AGTGAGAACACAATGGTATTTGG + Intronic
911151314 1:94599356-94599378 AGGAAGTAAAGAATGGCTTTGGG + Intergenic
911482218 1:98458404-98458426 TGGTAGAACAGCATGGCATATGG + Intergenic
912630092 1:111239275-111239297 AGGGAGAACAGAGTGGACATTGG + Intronic
913171122 1:116233386-116233408 AGGCAGACCAGAGTGGCAGTGGG + Intergenic
914263761 1:146020411-146020433 AGGATGAACAGACTGGAATTTGG + Intronic
914793057 1:150896420-150896442 AGGCAGAACAGAAAGGTATCAGG - Intergenic
916253393 1:162761298-162761320 AGGGGGAAGGAAATGGCATTAGG - Exonic
917190680 1:172415413-172415435 AGGGAGGAAAGAAAGGCAATAGG - Intronic
918335821 1:183511723-183511745 TGGGAGAACAGAATGAAATGGGG + Intronic
918502157 1:185209358-185209380 GGGGACTACAGAATAGCATTAGG - Intronic
918527004 1:185475742-185475764 ATGGAAAACAGAAAGGCTTTGGG - Intergenic
919739949 1:200975355-200975377 AGGGAGAACAGGAGGGCTTGGGG + Intronic
922254477 1:223881049-223881071 AGAGAGAAGAGAATTGAATTGGG + Intergenic
922981305 1:229829279-229829301 AGGGAGAACAGGGTGGCAATTGG - Intergenic
923235901 1:232032507-232032529 AGGAGGTACAGAATGGCCTTGGG + Intronic
1063168868 10:3487915-3487937 AGGGAGGACAGCTTGGCAGTAGG - Intergenic
1063210587 10:3877276-3877298 AGGGAGAACAGAAAAGCAGAAGG - Intergenic
1064096851 10:12430104-12430126 AGAGAGAACAGCAAGGCAGTGGG - Intronic
1064755099 10:18566247-18566269 ATGGAGAACGGAATGGAATGTGG - Intronic
1064755462 10:18568800-18568822 ATGGAGAACGGAATGGAATGTGG - Intronic
1065445348 10:25792955-25792977 ACTGTGAACATAATGGCATTAGG + Intergenic
1065745474 10:28837192-28837214 AGAGAGAAAACAAAGGCATTTGG - Intergenic
1066047356 10:31604948-31604970 AGGCAGAAGGGAATGGCAATGGG - Intergenic
1066486212 10:35847538-35847560 AGGGAGAAAAGAATAGGATGAGG - Intergenic
1068996206 10:63207795-63207817 AGAGAAAACTGAATGGCATGTGG - Exonic
1069135289 10:64756078-64756100 AGAGAAAAGAAAATGGCATTAGG + Intergenic
1069154713 10:65013464-65013486 TGGTGGAAAAGAATGGCATTTGG - Intergenic
1069597776 10:69683660-69683682 AGGGAGAAAAGGCAGGCATTTGG - Intergenic
1073891161 10:108103477-108103499 AGGGAAAATACAATGGCATCAGG + Intergenic
1074847008 10:117407243-117407265 GTGGACAACAGAATGGCAATTGG - Intergenic
1075102670 10:119517296-119517318 AGGGTGGACAGCATGGCTTTCGG - Intronic
1075651770 10:124132099-124132121 AGGGAGAGGGGAATGGCATTTGG - Intergenic
1076863467 10:133154962-133154984 TGGGAGAACAGGATGGTAATCGG + Intergenic
1077352906 11:2101020-2101042 AGGGAGAAGCCAAGGGCATTGGG + Intergenic
1077383531 11:2258504-2258526 AGGGAGAAGCCAATGGCATAGGG + Intergenic
1077489647 11:2854974-2854996 TGGGAGAACTGGATGGCATTTGG - Intergenic
1077944606 11:6881810-6881832 AACCAGAACAGAATGGTATTTGG - Intergenic
1077958656 11:7049076-7049098 ACAGTGAACAGAAGGGCATTGGG + Intronic
1078656712 11:13247375-13247397 AGGGAGAGGAGCATGGCATGAGG - Intergenic
1078904512 11:15671532-15671554 AGAGAGCATTGAATGGCATTGGG + Intergenic
1082820184 11:57539443-57539465 AGAGAGAACTGAATGCCAGTAGG - Intergenic
1082854322 11:57792893-57792915 AGAGAGAACAGAATTCCAGTTGG + Intronic
1083581048 11:63825709-63825731 TGGGAACACAGAATAGCATTTGG + Intronic
1084650753 11:70487912-70487934 GGGAAGAACAGAAAGGCACTGGG + Intronic
1085053611 11:73392037-73392059 AGGGAAAACAGGAGGGCAGTGGG + Intronic
1086451407 11:86920617-86920639 AGAGAGAACAGAGTGGGAATAGG + Intronic
1086883504 11:92176616-92176638 TTGGAGAACAGAATGGGCTTTGG - Intergenic
1090653386 11:128825124-128825146 AGGGAGAAAAGAATGGAAGAAGG - Intergenic
1090655474 11:128840805-128840827 TGAGAGAACAGAATTGAATTAGG - Intronic
1092092646 12:5816115-5816137 AGGGAGAACAGGACTGGATTTGG - Intronic
1092238188 12:6822475-6822497 AGGAAGCACATAATGGCTTTAGG - Intronic
1092836289 12:12492221-12492243 AAGGGAAACAGAATGGCATATGG - Intronic
1093153305 12:15649618-15649640 AGGGAAAAAAAAATTGCATTAGG + Intronic
1093227439 12:16503002-16503024 AGGTAGAGCAGTATGACATTAGG + Intronic
1093743730 12:22716127-22716149 AGGGAGAAAAAAAGGACATTTGG + Intergenic
1094087433 12:26608921-26608943 TTGGTCAACAGAATGGCATTTGG + Intronic
1095233698 12:39772163-39772185 AGGGAGTACAGCATGGCACAAGG + Intronic
1095833194 12:46609347-46609369 AGGGAGAACACACTGAGATTTGG + Intergenic
1096252458 12:50041694-50041716 AGGGAGAGAACAACGGCATTCGG + Intergenic
1096745433 12:53723885-53723907 AGGGAGAAGAGTATGGCCTGTGG - Intronic
1098581401 12:72103419-72103441 AAGGAGACCAGTATGGCATAAGG + Intronic
1099442144 12:82712053-82712075 AGGGAGCACAGAAAGGAAATGGG - Intronic
1099455279 12:82855639-82855661 CCAGAGAACAGAGTGGCATTTGG - Intronic
1100621771 12:96283254-96283276 AGGGAAATATGAATGGCATTTGG + Intronic
1102403499 12:112651742-112651764 AGGGAGAAGAGAATGGAGATGGG - Intronic
1103141377 12:118551647-118551669 GGGGAGAGCGGAATGGGATTGGG + Intergenic
1103260763 12:119586436-119586458 AGGGAGAACAGAGTTCTATTTGG - Intergenic
1104305253 12:127604625-127604647 GTGGAGAACATAAAGGCATTAGG + Intergenic
1105898482 13:24738374-24738396 AGGGAGAACAGAAGGGGCCTGGG - Intergenic
1106156078 13:27157810-27157832 AGGGAAGACAGACTGGTATTTGG - Intronic
1107699083 13:43029488-43029510 AGGGAGAATAAAATGCCATAGGG + Intronic
1108304426 13:49117021-49117043 AGGGAGAATAGAAGGGAATGAGG + Intronic
1108915853 13:55610188-55610210 AGGGAGAAGTCAATGGCTTTAGG + Intergenic
1110119308 13:71864428-71864450 AAGGAGACCAGAAGGACATTGGG - Intronic
1110629911 13:77697197-77697219 AGGGGGAACAGAAAGGCTTTGGG - Intergenic
1110803664 13:79729944-79729966 AGTGAGAACATAATAGTATTTGG + Intergenic
1110979295 13:81875122-81875144 AGCGAGAACATTATGGCAGTGGG + Intergenic
1110982656 13:81920605-81920627 TGGGAGAACTGAGTTGCATTAGG + Intergenic
1111049862 13:82867699-82867721 TGTAAGCACAGAATGGCATTGGG + Intergenic
1111064205 13:83069524-83069546 AGGGAAAAGGGAAAGGCATTGGG + Intergenic
1111377509 13:87399956-87399978 AGGGAGAAGAGAAAAGCCTTTGG + Intergenic
1111874135 13:93872198-93872220 TGTGATAACAGAATGCCATTTGG + Intronic
1111919694 13:94397153-94397175 AGAGAGGAAAGAAGGGCATTGGG + Intronic
1112919597 13:104595322-104595344 AGGGAGAACAAAAAAGCACTTGG + Intergenic
1114370867 14:22086619-22086641 AGAGATAACAAAATGTCATTAGG - Intergenic
1115418642 14:33166550-33166572 ATGGAGAACTGAAAGGCATTGGG - Intronic
1116023587 14:39489608-39489630 AGGGAGAAGAGAATTGCAGCAGG + Intergenic
1116440142 14:44941669-44941691 ATGGAGAACATAATGACTTTTGG - Intronic
1116997317 14:51337142-51337164 AGGGAAAAGAGAATGGGATTTGG - Intergenic
1117948086 14:61052544-61052566 AAGCAGAACAAAATGGCAGTGGG + Intronic
1117961006 14:61161455-61161477 AGGAATGACAGAAGGGCATTAGG + Intergenic
1118841291 14:69514911-69514933 AAGAAGAACAGAATGGCCTCAGG + Intronic
1119439491 14:74618803-74618825 AGGGAAAACAGCATGGACTTTGG - Intergenic
1120146321 14:80982490-80982512 AGGAGGAAGAGAATGTCATTGGG + Intronic
1121017107 14:90555534-90555556 TGGGAGGACAGGATGGCATGGGG + Intronic
1122555141 14:102574895-102574917 AGGGAGAACAGACTGGGAAAAGG - Intergenic
1124484360 15:30102109-30102131 ATGGAGAACACAGTGGCATCAGG + Intergenic
1124519223 15:30395115-30395137 ATGGAGAACACAGTGGCATCAGG - Intergenic
1124539433 15:30571106-30571128 ATGGAGAACACAGTGGCATCAGG + Intergenic
1124759217 15:32436466-32436488 ATGGAGAACACAGTGGCATCAGG - Intergenic
1124974533 15:34520577-34520599 ATGGAGAACACAAGGGCATCAGG - Intergenic
1127705336 15:61541338-61541360 AGTGAGGACAGAATAGCAGTTGG - Intergenic
1128556918 15:68638096-68638118 AGGGAGACCAGGATGGCCCTGGG + Intronic
1129252985 15:74318891-74318913 AGGGAGGACAGAAGGGCTTCTGG + Intronic
1129650899 15:77488060-77488082 AAGAAGATAAGAATGGCATTGGG + Intergenic
1130606425 15:85321435-85321457 AGGGAGAACAGGGTGTAATTAGG - Intergenic
1130750472 15:86706667-86706689 AAGGAGAACAGCATGGTGTTAGG - Intronic
1131141986 15:89984136-89984158 AGGGAGAGAAGAAAGGCATTTGG - Intergenic
1132850919 16:2024606-2024628 ATGGAGAACAGCATGGCAGAGGG - Intergenic
1133675071 16:8063469-8063491 AGGAAGGGCAGAATGGCATCAGG + Intergenic
1135214697 16:20555157-20555179 AGGAAGAACAGCATGGGACTAGG - Intronic
1135973000 16:27085925-27085947 AGTGAGAACATAACGGTATTTGG - Intergenic
1136174088 16:28505790-28505812 AGGGAGAGCAGGATGGACTTCGG - Intronic
1137448034 16:48544173-48544195 GGGTAGAAAAGCATGGCATTTGG + Intronic
1139952147 16:70677693-70677715 GGGGAAAAGAGGATGGCATTTGG - Intronic
1140171458 16:72609198-72609220 ATGGAGAAAGGAAAGGCATTAGG + Intergenic
1140669529 16:77263510-77263532 GGAGGGAACAGAATGGCACTGGG - Intronic
1140885624 16:79240100-79240122 ATAGAGCCCAGAATGGCATTGGG + Intergenic
1141028932 16:80571274-80571296 AGGAAGAACAGAAGGTCATGGGG - Intergenic
1141261722 16:82460298-82460320 GGAGAGACCAGAAAGGCATTGGG - Intergenic
1144223362 17:13120360-13120382 AGGGTGAACTGAATTGCAGTGGG + Intergenic
1145095364 17:20020782-20020804 AGGGAGAAGAGAATGAGAGTGGG - Intronic
1145114995 17:20201040-20201062 GGGGAGAACAGACTGCAATTTGG + Intronic
1146186838 17:30729734-30729756 AGGGAGGACAGAATGGGGCTTGG + Intergenic
1146233770 17:31137912-31137934 ACAGAAACCAGAATGGCATTGGG - Intronic
1146565621 17:33910531-33910553 AAGGAAAACAGAATGGGATGAGG - Intronic
1152212672 17:79010659-79010681 AGGGAATACAGAACGGCAATGGG - Intergenic
1153781037 18:8495458-8495480 AGGATGAACAGACTGGCAGTGGG - Intergenic
1155302585 18:24444477-24444499 AGAGAGAACAGAATGACACATGG - Intronic
1156002579 18:32401718-32401740 AGGTAGAACACACTGCCATTCGG + Intronic
1156632040 18:38981905-38981927 ATGGATAACAGAATGGAATGTGG - Intergenic
1161798521 19:6402009-6402031 ACAGAAAACAGAATGACATTTGG + Intergenic
1162972058 19:14186763-14186785 AGGGAGGACAGAATGGGGCTTGG - Intronic
1163193002 19:15693201-15693223 GGGGAGAAGTAAATGGCATTGGG + Intronic
1164037555 19:21467793-21467815 AGGAAGATTTGAATGGCATTTGG + Intronic
1164633212 19:29774963-29774985 ATGGAGCACAGAATGGCTTATGG + Intergenic
925536088 2:4918124-4918146 AGGGAGAATAGAATTTTATTTGG - Intergenic
925692502 2:6539254-6539276 AGTGAGAACAGAGTGGTATTTGG - Intergenic
925740286 2:6999568-6999590 AGAGGGAAAAGCATGGCATTTGG + Intronic
926803844 2:16686285-16686307 AGGGAGAAAAGAACGGAAGTAGG + Intergenic
930148374 2:48031446-48031468 AGGGAGAACAGGATGACCCTGGG - Intergenic
931760760 2:65414804-65414826 AGGGAGAACAGAGTTGCAGAGGG + Intronic
932056622 2:68449506-68449528 AGGAACAAAATAATGGCATTCGG - Intergenic
932253608 2:70265489-70265511 TGGGAGTAAAGAATGGCATCCGG - Intronic
932759091 2:74427918-74427940 AGGGAGCAAAGAAGGGCAATTGG + Intronic
934640095 2:96022756-96022778 AGGGAGAACAGAGAGCCACTGGG + Intronic
934771233 2:96908789-96908811 AGGGAGATGAGAATGGAAGTTGG - Intronic
935009113 2:99114443-99114465 AGAGAGAACAAAATGGAAATAGG - Intronic
936583420 2:113727590-113727612 AAGAAGAACAGAAAGGCATGTGG - Intronic
939608582 2:144282534-144282556 AGGGAAAGGAGAATGGAATTAGG + Intronic
940534119 2:154916741-154916763 AGGGACTAGAGAATGGCATGTGG - Intergenic
942202089 2:173581613-173581635 AGGAAGAACGAAAGGGCATTGGG + Intergenic
942274777 2:174312647-174312669 TTGGAGAACAGACTGGCCTTTGG + Intergenic
944577270 2:201101684-201101706 AGTGAGAACATAATGACATTTGG + Intergenic
944580070 2:201124704-201124726 AGGGGGAACAGAATGGCTAGGGG + Intronic
946045708 2:216819269-216819291 AGAGAGAACAGAAGTGCATAGGG + Intergenic
946399159 2:219459784-219459806 AGGGAAGTCAGAATGGCATTTGG - Intronic
946462258 2:219879075-219879097 AGGACTAAAAGAATGGCATTAGG - Intergenic
946798479 2:223383204-223383226 AGGAGGAAAAGGATGGCATTTGG - Intergenic
948040656 2:234899029-234899051 AGGGAGAACAGAGTGGGAACAGG - Intergenic
1169349600 20:4857468-4857490 AGGGAGGTCAGAAGGTCATTAGG - Intronic
1170153488 20:13249199-13249221 GGGGAGAACAGAAGATCATTAGG - Intronic
1170404284 20:16020023-16020045 AAGGGGAACAGACTGGCAGTGGG - Intronic
1170493296 20:16899943-16899965 AGGAAGAACAGAGTGGAAATCGG - Intergenic
1172317013 20:33963685-33963707 AGAGAGAACAGAATGGGGGTAGG - Intergenic
1173539900 20:43843428-43843450 CAGGAGATCAGAATGGCTTTGGG - Intergenic
1174130083 20:48338130-48338152 AGTGAGAACATAATGATATTTGG - Intergenic
1175616847 20:60407109-60407131 AGGGACAACGGACTGGCCTTGGG - Intergenic
1175965183 20:62656758-62656780 AGGAAGAACAGGATGCCCTTGGG - Exonic
1177353614 21:19978402-19978424 AGGGATAACAGAAGGGAACTGGG + Intergenic
1178060153 21:28844312-28844334 AGGGAGAGAAGTATGGAATTAGG - Intergenic
1178359118 21:31933314-31933336 AAGGAGAAGAGAATGGCCCTGGG - Intronic
1179267024 21:39812802-39812824 AGGGGGAACAGAAAGTCATATGG + Intergenic
1180705517 22:17807648-17807670 AGGGAGTCCAGAATGGAAGTAGG - Intronic
1182856329 22:33520632-33520654 AGGCAGAGCAGACTGGGATTAGG - Intronic
1183457569 22:37930958-37930980 TAGAAGCACAGAATGGCATTGGG - Intronic
1183947095 22:41332654-41332676 AGGGAGAGCAGGATGGGTTTCGG - Intronic
949987650 3:9553129-9553151 AGGGAGCTCAGAAGGGAATTTGG + Intronic
951562040 3:23977708-23977730 AGGGAGATCAAAATGGTTTTTGG - Exonic
952987680 3:38800742-38800764 AATGAGAACAGAGTGGAATTTGG + Intergenic
953784701 3:45902434-45902456 AAGGAGAACAGAAGGAAATTAGG - Exonic
954781670 3:53066516-53066538 TGGGAGAAGAGAATTCCATTTGG - Intronic
955401088 3:58592019-58592041 AGGGTGAACAGAATTGCCTGGGG + Intronic
956079018 3:65537528-65537550 AAGGAGGAAAGAATGGCAGTGGG + Intronic
956376824 3:68622041-68622063 TGGAAGAACAGAGTGGCATCTGG - Intergenic
957874258 3:86124902-86124924 GGAGAGAGCAGAATGGGATTAGG + Intergenic
958041934 3:88236426-88236448 AGTGAGAACAAAATGTAATTTGG + Intergenic
959478425 3:106840109-106840131 AGATAGAACAGAATGGCTTGTGG - Intergenic
960244640 3:115386720-115386742 AGGAGGAACATAATGGAATTGGG + Intergenic
960774807 3:121237421-121237443 TAGGAGAACAGAATGGTTTTGGG - Intronic
961670018 3:128522302-128522324 ATGAATAACAGAAGGGCATTTGG + Intergenic
962020587 3:131497027-131497049 AGGGAGAACAGAAAGGAAAATGG - Intronic
962999407 3:140664210-140664232 ATGGATAACAGCATAGCATTTGG - Intergenic
963920954 3:150905027-150905049 AAGGAGAACACACTGGCTTTGGG + Intronic
964163918 3:153678398-153678420 AGAGAAAACAGACTGGCAATAGG - Intergenic
964337874 3:155677133-155677155 TGGGAGAAGAAAATGGCAATAGG - Intronic
964834076 3:160917995-160918017 AGGGAGGGCACAAAGGCATTAGG - Intronic
965133540 3:164732472-164732494 TGGGAGAAGACAATGGAATTGGG - Intergenic
965744307 3:171907832-171907854 AGGAAAAGAAGAATGGCATTAGG - Intronic
967352354 3:188527728-188527750 AGGGAGCACAAAAAAGCATTTGG - Intronic
969362933 4:6676718-6676740 TGGGGGAAAAAAATGGCATTGGG + Intergenic
970598217 4:17619079-17619101 AAAGAGAACAGCATGGCAGTTGG - Intronic
971552398 4:27974404-27974426 AGGGAGCAGATAATGGGATTAGG - Intergenic
971662639 4:29439844-29439866 AGACAGAACTGAATGGCATTTGG + Intergenic
973549867 4:52023048-52023070 AGTGAAAACAACATGGCATTTGG + Exonic
973928609 4:55765798-55765820 AGGGAAGACAAAATGGAATTGGG - Intergenic
974901300 4:68001841-68001863 AGAGAGAACAGACTTGTATTGGG - Intergenic
975910968 4:79266295-79266317 AAGCAGAGCAGAATGCCATTAGG - Intronic
976199424 4:82563656-82563678 AGAGAGAAATGAATGGCATGGGG - Intergenic
977065631 4:92310799-92310821 AGGAGGAACAGAAAGGAATTGGG + Intronic
978044473 4:104109249-104109271 AGTGAGAACATAATGGTATTTGG - Intergenic
978556520 4:109986699-109986721 AGGTAGGGCAGAGTGGCATTTGG + Intronic
978844128 4:113251948-113251970 AGGGAGAATAGTCTAGCATTAGG - Intronic
979830355 4:125293043-125293065 AGGCAGAACATAAAGGAATTTGG + Intergenic
980184537 4:129445829-129445851 AGGAAGAAGAGAATGTAATTAGG - Intergenic
980688925 4:136265819-136265841 AGTGAGAACATATTGGTATTTGG - Intergenic
983501718 4:168507035-168507057 AGGGAGAACAGAGCTGGATTGGG - Intronic
984510133 4:180669122-180669144 AGGCAGCACAGATTGGCCTTAGG + Intergenic
984817737 4:183853462-183853484 AGGTAGAAATGAATTGCATTAGG + Intronic
984833450 4:183997784-183997806 ATGTAGAACAAAATGGAATTTGG - Intronic
984908957 4:184653867-184653889 ATGGAGAACAGTAAGGCATCTGG - Intronic
986165726 5:5270105-5270127 AGGCAGGAAAGCATGGCATTGGG - Intronic
987007696 5:13727109-13727131 AGGAAGAACATAAAGGCATTAGG - Intronic
987530599 5:19114206-19114228 AGGGAGAAATGACTGGCTTTAGG + Intergenic
988296758 5:29373570-29373592 AGGGATTACAAAATGGCATTAGG + Intergenic
991038784 5:62155140-62155162 AGGGAGATAAGTATGGCACTTGG + Intergenic
991328418 5:65463987-65464009 AGGGAGAAGATCATGGCATGAGG - Intronic
991354714 5:65756184-65756206 AGTGAGAAGAGAAAAGCATTGGG - Intronic
992209350 5:74462792-74462814 AGAGTGAACAGATTGGCACTTGG - Intergenic
994269760 5:97762920-97762942 AGGATGGACAGAATGGCATTTGG + Intergenic
995028964 5:107458029-107458051 AGAGGGAACAGCATGGGATTTGG - Intronic
996050440 5:118926307-118926329 AGTGAGAACATAACGGAATTTGG - Intronic
997189370 5:131916132-131916154 AAGGAGGATAGAATGGTATTTGG - Intronic
997654917 5:135547539-135547561 GGGGAGAAGAGAAGGGCATGGGG + Intergenic
998817480 5:146028809-146028831 TGGGAGAATAGAAGGGCTTTGGG + Intronic
999143548 5:149378342-149378364 AGGGAGAAGTGGATGGCAATGGG - Intronic
999742537 5:154567265-154567287 AGGGAGAACAGATGGTCACTTGG + Intergenic
1000611165 5:163376653-163376675 AGGAAGAACATAATCACATTCGG + Intergenic
1000649421 5:163797750-163797772 AGGAATAAAATAATGGCATTTGG - Intergenic
1003169734 6:3711875-3711897 AGTAACAACAGAATGGCACTTGG + Intergenic
1003294143 6:4809028-4809050 AGGGCGTACAGAATGGGAATGGG - Intronic
1004014781 6:11722456-11722478 TGATAGAACAGAATGGCATGTGG + Intronic
1004319450 6:14621251-14621273 AGGTAGCACAGAATAGAATTGGG - Intergenic
1004836603 6:19538386-19538408 AGGGAGCACAGGAACGCATTGGG - Intergenic
1005898067 6:30195332-30195354 TGAGAGAACAGAATGACATCTGG + Intronic
1006277584 6:33018018-33018040 AGGGAGATGAGAAGAGCATTAGG - Intergenic
1006380585 6:33694985-33695007 AGGGGGAGCAGAATGAGATTCGG + Exonic
1007350253 6:41268068-41268090 AGGGAAAAGAGCATGACATTTGG - Intronic
1008517997 6:52336308-52336330 AGAGAGAAAAGTATGGCCTTGGG - Intergenic
1009921801 6:70071726-70071748 AGGGAGAACAGAATGGCATTGGG + Intronic
1012540150 6:100353164-100353186 AGTGAGAACATAACAGCATTTGG + Intergenic
1014580863 6:123135875-123135897 ATGGAGAACAGAATGACATCAGG + Intergenic
1019208237 6:170381111-170381133 AGGGAGGTCAGCTTGGCATTAGG + Intronic
1020371025 7:7432096-7432118 AGGGAGAAAAGATAGGTATTTGG + Intronic
1022247806 7:28577349-28577371 AGTGAGAACAGAATAGGGTTTGG + Intronic
1022691916 7:32664494-32664516 ATGGAGAAGAGAAAGTCATTAGG + Intergenic
1022919583 7:34999040-34999062 ATGGAGAAGAGAATGTCATTAGG + Intronic
1023167669 7:37358830-37358852 ATGAAGAACAGACTGGCATGGGG + Intronic
1025070642 7:55895315-55895337 AGGGAGCTCAGGATGCCATTCGG + Intronic
1025627210 7:63233054-63233076 AGGGAGAGCAGCACGGCCTTGGG + Intergenic
1025958246 7:66199112-66199134 AGGGAGAACAGGAGGACACTTGG - Intergenic
1026129441 7:67607946-67607968 AGGGAGAGAGGAATGGTATTGGG + Intergenic
1027907323 7:84201969-84201991 TGTGAGAACACAATTGCATTGGG - Intronic
1027984450 7:85269080-85269102 AAGCAAAACAGCATGGCATTGGG + Intergenic
1028559581 7:92159493-92159515 AGGGAGAAGAGAATGGGATAAGG - Intronic
1028658820 7:93242948-93242970 AAGGAGAACTGAAGGGCACTAGG + Intronic
1028762668 7:94511855-94511877 AGGGAGAATAGAATGTCAGATGG + Intronic
1029171227 7:98630373-98630395 TGGGAGGACACAATGGCACTGGG - Intergenic
1029705471 7:102273619-102273641 AGGGAGAACCCAATGGTTTTAGG - Intronic
1030161182 7:106510058-106510080 AGGGAGAATAGAAGGGAAGTAGG + Intergenic
1031162314 7:118183217-118183239 AGTGGGAACAGTATCGCATTGGG + Intergenic
1031354284 7:120770903-120770925 GGGGAAAATAGAATGGAATTAGG + Intergenic
1031402786 7:121345563-121345585 AGGGAGAACAGGAAGCCATTTGG + Intergenic
1031878626 7:127170666-127170688 ATGAAGAAAATAATGGCATTTGG + Intronic
1032332344 7:130992136-130992158 AGGGACAACAGAATGGTTTCTGG + Intergenic
1032821695 7:135529936-135529958 AGGCAGGATGGAATGGCATTTGG - Intergenic
1033423786 7:141225231-141225253 TGGGAGAAGAGAAGGGCAGTAGG - Intronic
1034141593 7:148823604-148823626 ATGGGGAACAGAAAGTCATTGGG + Intronic
1036428870 8:8671058-8671080 AGGGGGAACATTTTGGCATTTGG - Intergenic
1036514232 8:9428957-9428979 AGTGAGAACATAACGGTATTTGG - Intergenic
1036665630 8:10735340-10735362 AGGCAGAACACAAGGACATTAGG + Intronic
1037924867 8:22836313-22836335 AGGGGGAAGAGAGTGGAATTTGG - Intronic
1038145282 8:24889165-24889187 AGGGAAAAAAGAATGAGATTTGG - Intergenic
1038912038 8:31975550-31975572 AAGGTGAACAGAATGACTTTAGG + Intronic
1042310267 8:67372221-67372243 ATGGAGAAGAGAAGGTCATTAGG + Intergenic
1044627534 8:94248649-94248671 AGGGAGAAGAGAATGAAATAGGG + Intergenic
1045953851 8:107883897-107883919 AGGGAGAAGAGAAAGGCAGAAGG + Intergenic
1046676584 8:117115426-117115448 AGGGAGTTCAAAATGGCAGTAGG - Intronic
1047218186 8:122896162-122896184 AGGGAGAACAGAAGAGCAATGGG - Intronic
1047458484 8:125038777-125038799 TGGGGGTACAGAATGGTATTTGG - Intronic
1048014595 8:130486051-130486073 AAGGAGTGCAGGATGGCATTTGG + Intergenic
1048057089 8:130877625-130877647 AGGAAGAAAAGCATGGCCTTTGG + Intronic
1048818659 8:138358807-138358829 AGGCAGAGCAGAATGCCACTGGG - Intronic
1049291868 8:141807610-141807632 ATGGAGAACAGTATGGCCTGGGG - Intergenic
1049535660 8:143179991-143180013 AGGCAGGACAGTATGGAATTAGG - Intergenic
1050755240 9:8994560-8994582 AGGGAGAAGAAAAGGGCAGTGGG + Intronic
1051043032 9:12837827-12837849 AGGGAGAAGGAAATGGCATATGG - Intergenic
1052003226 9:23313989-23314011 ATGGAGAACAGATTGTCATATGG + Intergenic
1053426946 9:38016382-38016404 GGTGAGAACAGAAGGGCATCTGG + Intronic
1055181696 9:73395952-73395974 AGTGAGAACATAATGATATTTGG + Intergenic
1055212824 9:73817993-73818015 AGTGTGAGCAGAATGGCTTTTGG - Intergenic
1056300812 9:85239026-85239048 AGGGAGAAAAAAATAGGATTTGG + Intergenic
1058363121 9:104174216-104174238 TGGGAGAAAAAAATGGCCTTTGG - Intergenic
1058649918 9:107166087-107166109 AGGAAGAACAAAATGGGACTGGG - Intergenic
1060203796 9:121669622-121669644 AGGGAGAGGAGGCTGGCATTGGG + Intronic
1061060619 9:128248555-128248577 ATGGAGAACACAAGGGCATCAGG - Intronic
1061882964 9:133577220-133577242 ATGGAGACCAGAAAGGAATTGGG + Intergenic
1062041308 9:134405489-134405511 AGGCAGGACAGAATGGCAGACGG - Intronic
1185749307 X:2597844-2597866 AGGGATAAGAGAATGGCATTGGG + Intergenic
1186273736 X:7918414-7918436 CAGGAGAACAGAATGGGATGGGG + Intronic
1186497621 X:10024495-10024517 AGGGAGAACCGAATGGCTCGGGG - Intronic
1186567147 X:10675738-10675760 AGAAATAACAGAATGGAATTAGG + Intronic
1186659214 X:11651373-11651395 AGTGAGAACATGATGGTATTTGG + Intronic
1188591578 X:31842956-31842978 AGTGAGAACAAAGTGGTATTTGG + Intronic
1188666228 X:32824560-32824582 ATAGAGAACAGAATAGCAGTTGG + Intronic
1189482672 X:41405331-41405353 ACTGAGTACAGAATGGCATAGGG + Intergenic
1190712044 X:53078378-53078400 AGGGAGAAGAGACTGGGCTTGGG - Exonic
1191895332 X:65986785-65986807 AGGGAGAACAGAAAGGAAGAAGG - Intergenic
1191911977 X:66161087-66161109 AGGGTGAGAAGCATGGCATTTGG - Intergenic
1192090324 X:68148285-68148307 AAGGAGAACAGACTAGCTTTGGG - Intronic
1192961797 X:76139011-76139033 AGGAAGAGCAGAATGGCCTGGGG + Intergenic
1194240148 X:91435343-91435365 AGGGAGAATAGATTCGTATTTGG + Intronic
1196324216 X:114383145-114383167 AGGGAGCATAGAATGACACTAGG + Intergenic
1196727900 X:118913745-118913767 AGTGAGAAAAGTATGGCAGTGGG + Intergenic
1197256762 X:124271854-124271876 AGTGAGAACATATTGGTATTTGG - Intronic
1198036099 X:132802954-132802976 AGGAAGGACAGAATGGGGTTGGG - Intronic
1198659208 X:138948483-138948505 AGAGAGACCAGAATGCCATGTGG + Intronic
1199285590 X:146050838-146050860 AGGGAGAAAAGAAAGGGGTTAGG + Intergenic