ID: 1009926323

View in Genome Browser
Species Human (GRCh38)
Location 6:70125396-70125418
Sequence CTCTGAGCTCGGAATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009926323_1009926328 -2 Left 1009926323 6:70125396-70125418 CCCTCCTCATTCCGAGCTCAGAG 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1009926328 6:70125417-70125439 AGAGCCCATGGTTCATTTTCCGG 0: 1
1: 0
2: 3
3: 22
4: 162
1009926323_1009926331 5 Left 1009926323 6:70125396-70125418 CCCTCCTCATTCCGAGCTCAGAG 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1009926331 6:70125424-70125446 ATGGTTCATTTTCCGGTCCCAGG No data
1009926323_1009926335 24 Left 1009926323 6:70125396-70125418 CCCTCCTCATTCCGAGCTCAGAG 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1009926335 6:70125443-70125465 CAGGATCCTCACTTGCCCTCTGG 0: 1
1: 0
2: 3
3: 18
4: 426

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009926323 Original CRISPR CTCTGAGCTCGGAATGAGGA GGG (reversed) Intronic
900171384 1:1270823-1270845 TTGGGAGCTGGGAATGAGGAGGG - Intronic
900500080 1:3000046-3000068 TTCTGGGCTAGGAATGAGGGTGG + Intergenic
901661507 1:10800613-10800635 CTCTGTCCTCGGAGTGAGAAAGG - Intergenic
902589051 1:17460470-17460492 CACTGAGCTGGGCAGGAGGAAGG - Intergenic
902721279 1:18305939-18305961 CTCTTAGCTGGACATGAGGAAGG - Intronic
902993421 1:20205466-20205488 TCCTGAGCTTGGAATGAGAAAGG + Intergenic
903045668 1:20562663-20562685 CTCTGAACAGGGAAGGAGGAAGG - Intergenic
904275893 1:29384131-29384153 CTCTCAGCTGGGCATCAGGAAGG + Intergenic
904631428 1:31845756-31845778 CACTGAGCTGGGAAAGAGAAAGG + Intergenic
907256164 1:53180685-53180707 CTCTGAGCTCTGACTGAGGGTGG + Intergenic
907748903 1:57243495-57243517 GTGTGTGCTAGGAATGAGGAGGG + Intronic
917204655 1:172559936-172559958 CTCTGAGGGAGGAATGAGGTGGG - Intronic
917831577 1:178895537-178895559 AGCTGAGATCTGAATGAGGAAGG + Intronic
921352381 1:214249413-214249435 GTCTAAGTTCGGAAAGAGGAGGG - Intergenic
921596955 1:217064909-217064931 CTCTGGGCTTTTAATGAGGAAGG + Intronic
922247401 1:223813808-223813830 CTCTGAGGTAGGAGTGATGATGG - Intronic
922538535 1:226401642-226401664 CTCTGAGAGGGGAATGAGGTAGG - Intronic
1064534050 10:16340622-16340644 CCCTGAACTCTGGATGAGGAGGG + Intergenic
1064971689 10:21073051-21073073 CTCTGTGCTGGGACAGAGGATGG + Intronic
1065806536 10:29398369-29398391 CTCAGAGCACAGAAGGAGGACGG - Intergenic
1065928920 10:30461853-30461875 TTCTCAGCTGGGACTGAGGATGG + Intergenic
1069621394 10:69839713-69839735 CCCTGAGGTCGGAATGAGCTTGG + Intronic
1070976563 10:80610084-80610106 GTCTGAGATGGGAAAGAGGATGG - Intronic
1071394913 10:85213421-85213443 CTCTGAGCCAGGAAAGAGCAAGG + Intergenic
1071812865 10:89202261-89202283 CTCTGAGCACTGAATAAGCAAGG - Intergenic
1073356231 10:102856927-102856949 CTCTAAGCAAGGAATGAGGATGG - Intronic
1073433513 10:103502133-103502155 CACTGAGCTAGGAAAGAGCAGGG + Intronic
1076934537 10:133558678-133558700 CCCTGAGGTGGGAATGAGGTTGG + Intronic
1080434058 11:32223637-32223659 GTCAGTGCTGGGAATGAGGAGGG - Intergenic
1081821272 11:45997969-45997991 CACTGGGCTCGTAAGGAGGATGG + Intronic
1083811915 11:65111096-65111118 CCCTGAGCTTGGAGTGAGGCGGG - Intronic
1083908185 11:65687908-65687930 CTCTGAGGGGGGAATGAGGTAGG + Intergenic
1084186241 11:67473514-67473536 CTCTGAGCGAGGAATGAGGTAGG - Intergenic
1084580574 11:70020530-70020552 CACTGAGCTGGGAAGGAAGAGGG - Intergenic
1085254066 11:75162481-75162503 CTGTGACCTAAGAATGAGGAAGG + Intronic
1086735974 11:90305995-90306017 CACTGAGCTCGGCCTCAGGAGGG - Intergenic
1089218669 11:116852383-116852405 CTCTGGGCTGGGAGTCAGGAAGG - Intronic
1089399471 11:118156172-118156194 ATCTGAGCTAGGAAGGAGGGTGG + Intergenic
1090208322 11:124897843-124897865 CTCTGAGCTCACAGTGAAGAGGG + Exonic
1090803625 11:130189483-130189505 CTCAGGGGTAGGAATGAGGAGGG - Intronic
1091044628 11:132314715-132314737 CTCTGAGCTGGGCAAGAAGAGGG + Intronic
1091725987 12:2846644-2846666 CTCTGGACTGGGAATGAGGGTGG - Intronic
1093166625 12:15811414-15811436 CTGGGAGCTAGGAGTGAGGAAGG - Intronic
1093250076 12:16792133-16792155 CTCTAAGCTCAGAGTTAGGATGG - Intergenic
1097398089 12:59100692-59100714 ATCTGAGCTCTGAAAGAGAATGG + Intergenic
1097399085 12:59107960-59107982 ATCTGAGCTCTGAAAGAGAATGG - Intergenic
1098203870 12:68085211-68085233 GACTGAGCTGGGAATGAGGAAGG + Intergenic
1099903742 12:88746425-88746447 CTCTGAGCTAGATATTAGGAAGG - Intergenic
1100548876 12:95628226-95628248 CTCTGAGCAGGGAGTGAGGCAGG + Intergenic
1101318094 12:103648236-103648258 CTCTCAGCTAGGAAGGAGCAGGG + Intronic
1101604583 12:106238506-106238528 CTGTCAGCTCTGAATGAGGAGGG - Exonic
1101766436 12:107704312-107704334 CTCTGAGCTCGGCCAGAGAAGGG + Intronic
1101844959 12:108355941-108355963 CTGTGAGCTCTGAGTGAGCAGGG - Intergenic
1102069254 12:110003731-110003753 CTCAGAGCTCGGCAGGAGGATGG + Intronic
1102548013 12:113670530-113670552 CTTTGAGCTTTGAGTGAGGATGG - Intergenic
1103157074 12:118694691-118694713 TTCAGAGCTGGGAACGAGGAAGG - Intergenic
1108675792 13:52736552-52736574 CTCTGAGCTGGGGACGAGGCTGG + Intronic
1110797185 13:79652955-79652977 CTGTGAACTGTGAATGAGGAGGG + Intergenic
1112120948 13:96410967-96410989 CTCATAGCCAGGAATGAGGATGG + Intronic
1112143209 13:96669488-96669510 ATCTGAGCTCACATTGAGGAAGG + Intronic
1113216586 13:108048093-108048115 CTCTAAGCTTGAAATGAGGAAGG + Intergenic
1113427188 13:110218354-110218376 CTCTACGCACGGAATGAGTACGG + Intronic
1115745044 14:36427915-36427937 CTATGAGCTCAGAACGATGATGG + Intergenic
1120948964 14:90023340-90023362 CTGTGTGCTTGGAATGGGGATGG + Intronic
1121599739 14:95194455-95194477 CTCTGGGCTGGGGAGGAGGAAGG + Intronic
1122691333 14:103533343-103533365 CTCTCAGCTGGGAAGAAGGAAGG - Intronic
1122874884 14:104659450-104659472 CTCTGGGCTGGGAAGGAGGGAGG - Intergenic
1123498113 15:20851095-20851117 ATTTAAGCTGGGAATGAGGAAGG - Intronic
1123591587 15:21862054-21862076 ATTTAAGCTGGGAATGAGGAAGG - Intergenic
1123979015 15:25582176-25582198 CTCTCACCTCGGATTGAGAAGGG + Intergenic
1125757964 15:42077858-42077880 CTCTGAGACAGGAATGAGGTAGG + Intronic
1126235931 15:46384168-46384190 CTCTCAGCTGAGAATGAGTAAGG - Intergenic
1128612760 15:69087254-69087276 CGATGAGCTTTGAATGAGGAAGG + Intergenic
1130066550 15:80609548-80609570 CCCTGAGCCTGCAATGAGGAGGG - Intergenic
1130548734 15:84875452-84875474 CTCTGGGGTCGGAATGAGCTAGG - Intergenic
1130906045 15:88241530-88241552 CTCTGGGCTGGAAAGGAGGAGGG + Intronic
1130915439 15:88300973-88300995 CTGTGAGCTCAGAAGCAGGATGG + Intergenic
1132314685 15:100880827-100880849 CTCTGAGCTGGGGCTGAGGAGGG + Intronic
1132858856 16:2060186-2060208 CTGTGAGCACAGAACGAGGACGG - Intronic
1133116776 16:3582080-3582102 CTGTGAGCACGGACAGAGGAAGG + Exonic
1135905686 16:26509770-26509792 CTCAGAGCTCTGAAAGTGGAAGG + Intergenic
1137624319 16:49898113-49898135 CTCTGCCCTCGGAATGAAAAGGG - Intergenic
1137682253 16:50359519-50359541 CTCTGAGCTCCGTAAGAGTAGGG - Intronic
1137923230 16:52512787-52512809 CTCTGAGTTAGGAATGTGGCTGG + Intronic
1140018785 16:71216494-71216516 CTCTGAGGTGGGGAAGAGGAGGG + Intronic
1142873805 17:2838620-2838642 CTCCGAGCTCCAGATGAGGAAGG + Intronic
1143637757 17:8176153-8176175 CTCAGAGATGGGAATGGGGACGG + Intronic
1148806457 17:50266450-50266472 GACTCAGCCCGGAATGAGGAGGG - Intergenic
1151399954 17:73849553-73849575 CTCTGAGGTCGGAGGGGGGAAGG + Intergenic
1152330749 17:79671196-79671218 CTCTGAGCCTGGATGGAGGAGGG - Intergenic
1153460728 18:5329821-5329843 CTCTTAGATGGGAAGGAGGAAGG + Intergenic
1153504327 18:5780262-5780284 CTCTGGGCTAGGGAAGAGGAAGG - Intergenic
1155836477 18:30591998-30592020 CTGTGAGCTGGGGATGAGTAGGG + Intergenic
1156023448 18:32625337-32625359 CTCTGCCCTGGCAATGAGGAAGG - Intergenic
1156073070 18:33237171-33237193 CACTGGGCTTGGAATGAAGATGG - Intronic
1156895511 18:42241048-42241070 CTCAGAGCTTGGAAACAGGAAGG + Intergenic
1157103326 18:44749921-44749943 CTTTGAGCTCACAATGAAGAAGG + Intronic
1157784306 18:50468408-50468430 CTCTGAGCTACTAATGAGGGAGG + Intergenic
1160350489 18:78174302-78174324 CTGCGAGCTCTGAATGAGGGAGG + Intergenic
1160523716 18:79523321-79523343 CTCTATGCTGGGAATGATGAGGG - Intronic
1160528951 18:79552538-79552560 CTCTGAGCTGGGGAAGAGGCTGG + Intergenic
1161396219 19:4046079-4046101 CCCTGAGCTAGGGAGGAGGAAGG + Exonic
1161515770 19:4695471-4695493 CTCTGTGCTCGGGATGAACAGGG + Exonic
1162846836 19:13399339-13399361 CTCTGAGCAAGGAAGGAGGGAGG - Intronic
1164571193 19:29375687-29375709 CTCTGAGGTCGGAGGTAGGATGG - Intergenic
1166563628 19:43749775-43749797 CCCTGGGCTGGGAATCAGGAGGG - Intronic
1166983345 19:46645005-46645027 CTTTGAGCTCGGAAAGAGCAGGG - Intergenic
1167369275 19:49071245-49071267 CTCTGGGCTGGGACTGTGGAGGG - Intronic
1167471353 19:49677834-49677856 CCCGGAGCTCGGAAGGAGGTTGG - Intronic
928839063 2:35583934-35583956 CTCTGAGAGGGGAATGAGGTAGG - Intergenic
929646894 2:43637269-43637291 CTCCGAGCTCGGCTTGAGGCGGG + Exonic
930157131 2:48117203-48117225 CTCTGAGTTGGGAATGCAGACGG - Intergenic
932579355 2:72983497-72983519 CCCTGAGCTCCTCATGAGGAAGG - Intronic
934551137 2:95262558-95262580 CTCTGAGCCTGGGATGTGGAAGG + Intergenic
935641334 2:105293444-105293466 CTCTGAGTTCTGAATTAGCAAGG - Intronic
936020492 2:108990804-108990826 GTCTGAACTCGGCATGAGCAGGG - Intergenic
938388780 2:130887824-130887846 CACTGTGCTGGGAAGGAGGATGG + Intronic
941169637 2:162120853-162120875 CCATAAGCTGGGAATGAGGATGG + Intergenic
941827549 2:169916915-169916937 GTCAGAGCTCAGACTGAGGAGGG - Intronic
945285660 2:208078851-208078873 CTCTGGGCTGGTACTGAGGAGGG - Intergenic
946061084 2:216942075-216942097 CTCTGTGCCAGGAATGAAGATGG - Intergenic
946160104 2:217830680-217830702 CTCTGAGGAAGGAAGGAGGATGG - Intronic
948551636 2:238776502-238776524 CACTGAGCATGGAAAGAGGAAGG + Intergenic
948551639 2:238776542-238776564 CACTGAGCATGGAAAGAGGAAGG + Intergenic
948551642 2:238776582-238776604 CACTGAGCATGGAAAGAGGAAGG + Intergenic
948551677 2:238776982-238777004 CACTGAGCATGGAAAGAGGAAGG + Intergenic
948551696 2:238777182-238777204 CACTGAGCATGGAAAGAGGAAGG + Intergenic
948551707 2:238777302-238777324 CACTGAGCATGGAAAGAGGAAGG + Intergenic
948551734 2:238777582-238777604 CACTGAGCATGGAAAGAGGAAGG + Intergenic
1170004093 20:11646821-11646843 CTCTGATCTCGGAATGGAGTTGG + Intergenic
1172748027 20:37228367-37228389 CTCTGAGCTGGGAACTAGGGTGG + Intronic
1174556015 20:51396281-51396303 CTCTGAGCTCTGATAAAGGAAGG - Intronic
1174949351 20:55027618-55027640 CTCTGAGGGGGGAATGAGGTAGG - Intergenic
1177306351 21:19321871-19321893 TGCTGAGTTTGGAATGAGGAAGG - Intergenic
1181023277 22:20114295-20114317 CTCTGGGCTCGGCAGGAGGGAGG - Intronic
1182017854 22:27055895-27055917 CCCTGAGGTGGGAATGAGCATGG + Intergenic
1183274593 22:36885671-36885693 CCCTGAGATCAGAATGGGGAAGG - Intergenic
1184098460 22:42329255-42329277 CTGTGTGCTGGGGATGAGGATGG - Intronic
1184410251 22:44322161-44322183 CTCTGAGCTCCTAGTGAGAATGG + Intergenic
1184515140 22:44957096-44957118 CTGTGAGCTCAGAGGGAGGAGGG - Intronic
1184613539 22:45622198-45622220 CTCTGATCTTGGAATGGGGTTGG + Intergenic
1185098316 22:48823572-48823594 CTCTGAGCTAGGAGAGAAGAGGG - Intronic
950207552 3:11092362-11092384 CTCTGATCTCAGAATAAGTATGG + Intergenic
952011471 3:28905014-28905036 CTCTGAGCTGGGTAAGAAGAGGG - Intergenic
953987023 3:47451928-47451950 CCCTGAGATGGGAATGAGGTTGG - Intronic
958270604 3:91494371-91494393 CGCTGAGCTCTGAATGGAGAAGG - Intergenic
958595374 3:96215961-96215983 CTCTGAGTGGGGAATGAGGTAGG - Intergenic
959838092 3:110944206-110944228 CTCTTAGCTAGGATTGAGAATGG - Intergenic
961710287 3:128823269-128823291 CTCTGGGCTCTGAATCAGGGTGG + Intergenic
962007166 3:131360977-131360999 CTCTGAGCTATGAAGGAGGGTGG - Intergenic
962009531 3:131380693-131380715 CTCTGAGCTATGAAGGAGGGTGG - Intergenic
962693567 3:137925794-137925816 CACAGAGCTGGGAAGGAGGAAGG + Intergenic
964521258 3:157571011-157571033 CTCTGTGCTATGAATGAAGACGG + Intronic
969374078 4:6751665-6751687 CTCTGGGCTGGGAATTAGGGGGG - Intergenic
973076159 4:45928889-45928911 CTCTCAGCTAGGAATGAGGTAGG + Intergenic
980076289 4:128297145-128297167 CTCTAAGTTAGGAATGAGGTTGG - Intergenic
981452172 4:144911255-144911277 CTGTCAGCTCAGAGTGAGGATGG + Intergenic
982158126 4:152540866-152540888 CTCTGATCTCAGAATGGGGTTGG - Intergenic
984842603 4:184082124-184082146 CTCTGAGCCAGGAATGTGCATGG + Intergenic
987033110 5:13993980-13994002 CTCAGAGGTCGGAAGGAGGAAGG + Intergenic
990240274 5:53810141-53810163 CTCTGAGCAGGGGATCAGGAGGG - Intergenic
990716263 5:58640394-58640416 CTCGGAGTGTGGAATGAGGAAGG + Intronic
994787261 5:104180590-104180612 CTAAGAGCTTGCAATGAGGAGGG - Intergenic
995726984 5:115191615-115191637 CTCTGAGGTATGAATGGGGAAGG - Intergenic
998108985 5:139486713-139486735 CCCTGAGTTTGGAAGGAGGATGG + Intergenic
998625432 5:143840721-143840743 CTCTGAGGTCCACATGAGGAAGG - Intergenic
999222107 5:149988902-149988924 CTGTGAGGTGGGAATGAGGTTGG - Intronic
1000101285 5:158019343-158019365 GTATGATCTTGGAATGAGGAAGG - Intergenic
1002562608 5:180092481-180092503 CTCTGAGCTGAGAGTAAGGATGG + Intergenic
1002576367 5:180176412-180176434 CTCTGGGCTCTGCATGAGGCAGG + Intronic
1003383613 6:5647618-5647640 CTCTTACCTCTGAATGAAGAAGG - Intronic
1003397245 6:5763934-5763956 CTCTGACTTTGGACTGAGGATGG - Intronic
1006448447 6:34092572-34092594 CTCTGAGCAGGGCACGAGGAAGG - Intronic
1008906300 6:56681164-56681186 CTCTGAGCTAGGAATGCAGGAGG - Intronic
1008984540 6:57526974-57526996 CGCTGAGCTCTGAATGGAGAAGG + Intronic
1009172587 6:60419865-60419887 CGCTGAGCTCTGAATGGAGAAGG + Intergenic
1009926323 6:70125396-70125418 CTCTGAGCTCGGAATGAGGAGGG - Intronic
1011590124 6:88963644-88963666 CTCTGACCTCGGAAAGGGGGCGG - Intergenic
1014101924 6:117520479-117520501 CCCTGAGCTAGGGAGGAGGATGG - Intronic
1015307434 6:131725415-131725437 CTCTGAGCTCGTATAGTGGAAGG + Intronic
1015910937 6:138167064-138167086 CTCTGAGATGGGAATGAGAATGG - Intronic
1017082451 6:150682619-150682641 TTCTGAGTTCGGTATTAGGATGG - Intronic
1018220656 6:161575015-161575037 TTGTGAGCACGGCATGAGGATGG - Intronic
1018352251 6:162972029-162972051 CTCTGACCTCCGCATGAGGATGG + Intronic
1021031859 7:15747066-15747088 GCCTGAGCTGGGAATGGGGAGGG + Intergenic
1023700106 7:42883850-42883872 CTCCGATCTCGGAGTGAGGTTGG - Intergenic
1023968068 7:44973650-44973672 CTCTGAGCTCCCCATGAGGTGGG - Intronic
1024544234 7:50503432-50503454 CTAGGATCTCTGAATGAGGAAGG + Intronic
1026587961 7:71672352-71672374 ATCTGATCTCTGAATGAGGAAGG + Intronic
1030850094 7:114473061-114473083 ATCTAAGCTTGGAATGAGTAAGG + Intronic
1031082995 7:117276368-117276390 CTCTGAGCTTGGTGTGAAGAAGG - Intergenic
1035111984 7:156490958-156490980 ATTAGAGCTCGGAATTAGGAAGG + Intergenic
1037195457 8:16183331-16183353 CTCTGAACTCTGAACGAGTAGGG + Intronic
1038855654 8:31329088-31329110 CTCTAAGCTGGGAATAAGGCAGG - Intergenic
1039017399 8:33167153-33167175 CTCTTAGCTCAGACTCAGGAAGG - Intergenic
1041152669 8:54953049-54953071 CTCTCAGCTCGGACTGGGCATGG - Intergenic
1042004854 8:64169144-64169166 CTCTGACCTCAGAATGGGGTTGG + Intergenic
1043282851 8:78489785-78489807 TCCTGAGCTAGGAAGGAGGAAGG + Intergenic
1043611388 8:82067565-82067587 CTCTCATTTGGGAATGAGGAGGG + Intergenic
1048228612 8:132614650-132614672 CTCTGAGATGGGACTGAGGGAGG + Intronic
1048423186 8:134297303-134297325 CTGTGAGCCCGGAATGAGCATGG + Intergenic
1048475932 8:134742412-134742434 CTCTGAGATGGGAGAGAGGAGGG - Intergenic
1049113407 8:140664602-140664624 CTCTGAGCAGTGGATGAGGAAGG - Intronic
1053287178 9:36857374-36857396 CTCTGAGCTCTGAATGGAGTAGG - Intronic
1054907378 9:70422689-70422711 TTCTCAGCTCAGAGTGAGGAAGG - Intergenic
1057269338 9:93639890-93639912 CTCTGAGCTCTGAATGTGAATGG + Intronic
1058053536 9:100428398-100428420 TTCTGAGTTAGGATTGAGGATGG + Intronic
1059355312 9:113694689-113694711 AACAGAGCTAGGAATGAGGAGGG + Intergenic
1059389921 9:113992600-113992622 CTCTGAGCCCGGAGCGAGGCTGG - Intronic
1059641687 9:116223169-116223191 CTCTGTGCTCCCAGTGAGGATGG - Intronic
1060462304 9:123868541-123868563 CTCTGAGATTGGCATGTGGAGGG + Intronic
1061373606 9:130211632-130211654 CTCTGTGCTCGGTACCAGGAAGG - Intronic
1062299014 9:135853745-135853767 CTCTGAGCCTGGCAAGAGGAAGG - Intronic
1189171647 X:38915221-38915243 CTGTGAGCTGAGAGTGAGGAGGG + Intergenic
1192238298 X:69310265-69310287 CTCAGACCTCGGTATGGGGATGG - Intergenic
1194067190 X:89276209-89276231 CTCTGAGTGAGGAATGAGGTAGG - Intergenic
1194978690 X:100417905-100417927 ATCTGAGCTCTGAATGGGGGTGG - Intergenic
1195284261 X:103367860-103367882 CTCTGAGCTGGAAGTGGGGAGGG + Intergenic
1200068729 X:153517623-153517645 CTCTGAGCGCGGAGGGAGGGAGG - Intergenic
1200721352 Y:6610418-6610440 CTCTGAGTGAGGAATGAGGTAGG - Intergenic
1201066381 Y:10099536-10099558 CTCTCAGGTCTGAATGTGGATGG + Intergenic
1202127173 Y:21578848-21578870 CTCAGAGCGGGGAATAAGGAGGG + Intergenic