ID: 1009929483

View in Genome Browser
Species Human (GRCh38)
Location 6:70160169-70160191
Sequence GACCCACAGCTCCACGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 13870
Summary {0: 1, 1: 28, 2: 795, 3: 4974, 4: 8072}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009929480_1009929483 16 Left 1009929480 6:70160130-70160152 CCTGAGACTGGGTAATTTATAAA 0: 6401
1: 13084
2: 14111
3: 11019
4: 7181
Right 1009929483 6:70160169-70160191 GACCCACAGCTCCACGTGGCTGG 0: 1
1: 28
2: 795
3: 4974
4: 8072

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009929483 Original CRISPR GACCCACAGCTCCACGTGGC TGG Intronic
Too many off-targets to display for this crispr