ID: 1009935304

View in Genome Browser
Species Human (GRCh38)
Location 6:70227031-70227053
Sequence ATTTGGGTTTATAATGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 209}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009935300_1009935304 -7 Left 1009935300 6:70227015-70227037 CCCAAATACATACAGGATTTGGG 0: 1
1: 0
2: 5
3: 22
4: 158
Right 1009935304 6:70227031-70227053 ATTTGGGTTTATAATGAAGGTGG 0: 1
1: 0
2: 3
3: 20
4: 209
1009935296_1009935304 6 Left 1009935296 6:70227002-70227024 CCCAAAAAGTAGGCCCAAATACA 0: 1
1: 0
2: 2
3: 15
4: 183
Right 1009935304 6:70227031-70227053 ATTTGGGTTTATAATGAAGGTGG 0: 1
1: 0
2: 3
3: 20
4: 209
1009935302_1009935304 -8 Left 1009935302 6:70227016-70227038 CCAAATACATACAGGATTTGGGT 0: 1
1: 0
2: 0
3: 14
4: 130
Right 1009935304 6:70227031-70227053 ATTTGGGTTTATAATGAAGGTGG 0: 1
1: 0
2: 3
3: 20
4: 209
1009935297_1009935304 5 Left 1009935297 6:70227003-70227025 CCAAAAAGTAGGCCCAAATACAT 0: 1
1: 0
2: 0
3: 28
4: 308
Right 1009935304 6:70227031-70227053 ATTTGGGTTTATAATGAAGGTGG 0: 1
1: 0
2: 3
3: 20
4: 209
1009935294_1009935304 27 Left 1009935294 6:70226981-70227003 CCAGTGAAACAGAATAGAAAGCC 0: 2
1: 36
2: 352
3: 1758
4: 4652
Right 1009935304 6:70227031-70227053 ATTTGGGTTTATAATGAAGGTGG 0: 1
1: 0
2: 3
3: 20
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009935304 Original CRISPR ATTTGGGTTTATAATGAAGG TGG Intronic
905883389 1:41478782-41478804 ACTTGTGTTTATAATAAATGAGG - Exonic
907304030 1:53503962-53503984 ATTTCTGTTAATAATGAAAGGGG - Intergenic
909815005 1:79981748-79981770 ATTTGGGTTAGTAATGTAGTTGG - Intergenic
910519562 1:88104336-88104358 ATTTGGTTTTAAAATGCAGCTGG - Intergenic
911625722 1:100122114-100122136 ATTTGGTTTTATAATGATATTGG - Intronic
911669148 1:100588431-100588453 ATTTGGTGTAATAAGGAAGGCGG - Intergenic
911783951 1:101921011-101921033 ATTTGGGCTTATGGAGAAGGTGG - Intronic
912376554 1:109214153-109214175 AATTGGGTTTAGCATCAAGGAGG - Intronic
912964119 1:114222406-114222428 TTTTGGATGTATTATGAAGGTGG - Intergenic
917592994 1:176496600-176496622 ATCTGGGTTCATAGTGTAGGAGG - Intronic
918363484 1:183782941-183782963 ATTTCTGTTTATGATTAAGGTGG - Intronic
918426822 1:184419076-184419098 AATTAGTTTTATAATGAGGGAGG + Intronic
919811020 1:201408871-201408893 AACTGGGTTTTTAATGAAGAAGG + Exonic
919979169 1:202631689-202631711 ATTTAGGCTCAAAATGAAGGAGG + Intronic
921313862 1:213872114-213872136 AATTCGGTTTAAAATGAAAGTGG + Intergenic
921739243 1:218665170-218665192 TTTTGTGTTTATCATGAAGATGG + Intergenic
924434952 1:244031006-244031028 ATTTGGGTTTAGAATAACTGGGG - Intergenic
1064188045 10:13180562-13180584 ATTTGGGGTTATATTGAAGAAGG + Exonic
1064556499 10:16551688-16551710 ATTTGAGTTTTTAAAAAAGGAGG - Intergenic
1065330830 10:24597249-24597271 CTTTCGCTTTATAATGAAGCTGG + Intronic
1065746976 10:28851241-28851263 ATTTGTGATTGTAATGAAGGCGG - Intronic
1065890202 10:30114396-30114418 ATTTGGCTTTATCATCAAGTAGG + Intronic
1067163842 10:43849117-43849139 AAGTGAGTTTATAATGAGGGAGG + Intergenic
1070191647 10:74116937-74116959 ATTTGAGGATTTAATGAAGGCGG - Intronic
1070394438 10:76000155-76000177 ATTTGGGTTTTTGGTGATGGAGG + Intronic
1071494392 10:86157756-86157778 ACTTGCGTTTATAATTTAGGAGG - Intronic
1071965504 10:90847874-90847896 ATTTTATTTTATAATGAAAGGGG - Intronic
1071986826 10:91060423-91060445 ATTTATTTTTATAATGATGGTGG + Intergenic
1074849909 10:117431420-117431442 ACTCGGGTTTATGATGAAGCAGG + Intergenic
1081509725 11:43757937-43757959 ATTTGGGGGTATAATGGTGGAGG + Intronic
1082212796 11:49525919-49525941 ATTTGGGAATAACATGAAGGTGG - Intergenic
1083259800 11:61516736-61516758 ATTTGGATTTACAAGGAACGTGG + Intronic
1084057639 11:66646687-66646709 AGTTGGTTTTATAACAAAGGTGG - Intronic
1085555762 11:77420140-77420162 ATTTGGGTTGGTATTGAAGAAGG + Intronic
1086636800 11:89098590-89098612 ATTTGGGAATAACATGAAGGTGG + Intergenic
1088542311 11:110925894-110925916 TTTTAGGTTTATAAATAAGGTGG - Intergenic
1090535965 11:127641977-127641999 ATTTGGCTATATAATCAGGGAGG + Intergenic
1090565558 11:127988320-127988342 CTTTGTTATTATAATGAAGGTGG + Intergenic
1090619142 11:128546019-128546041 TTTGGGTTTTATAATGAAAGTGG - Intronic
1092507582 12:9119801-9119823 ATCTGTGATTATAATGAATGCGG - Intergenic
1092901601 12:13064873-13064895 ATCTGGGTTTAGAGTGAAGTGGG + Intronic
1093467167 12:19461318-19461340 AATTGCTTTTAAAATGAAGGCGG + Intronic
1093545363 12:20338746-20338768 ACTTGGGTTTAGAAGGAAGGTGG + Intergenic
1095078879 12:37971769-37971791 ATTGGGGTCTATAATGAAAAAGG + Intergenic
1097327781 12:58298455-58298477 AATTTTGTTTAAAATGAAGGAGG - Intergenic
1098153756 12:67575447-67575469 ATATGGGTTTATGAAGAAGGTGG + Intergenic
1098328125 12:69323722-69323744 ATTTGGGGGTGTAGTGAAGGGGG - Intergenic
1098835201 12:75416074-75416096 TTCTGGGTATATTATGAAGGTGG + Intronic
1099524545 12:83703752-83703774 ATTTGGAAATATAATCAAGGGGG + Intergenic
1100325826 12:93539081-93539103 ATTTGAGTTGATCATCAAGGAGG - Intergenic
1100693949 12:97069976-97069998 ATTTTCGTTTTTAATGAATGTGG + Intergenic
1101256057 12:102977910-102977932 GAATGGGTTTATAAAGAAGGGGG - Intergenic
1101770152 12:107742190-107742212 ATATGTGTTTATAATGAATCTGG - Intronic
1106847066 13:33748114-33748136 TTTTGGGGTCCTAATGAAGGAGG + Intergenic
1107517354 13:41143758-41143780 CTTTGGGTTTATAGTCAAGTTGG - Intergenic
1108233313 13:48372855-48372877 ATGTGTGTGTATTATGAAGGGGG - Intronic
1108926417 13:55752222-55752244 ATTTCGGTGTGTAATGTAGGTGG + Intergenic
1111394109 13:87642018-87642040 CTTTGTCTTTAAAATGAAGGAGG - Intergenic
1111413112 13:87902695-87902717 ATTTGGTTTTAAAATCAAAGGGG - Intergenic
1112727519 13:102321463-102321485 ATTTGTGTTTATAATGACCCTGG - Intronic
1114470990 14:22961590-22961612 GTTTGGGTTTATATTTAAGGAGG + Intronic
1114831281 14:26144826-26144848 ATCTGTTTATATAATGAAGGAGG - Intergenic
1118424317 14:65643065-65643087 ATTTTAGTTTTAAATGAAGGAGG - Intronic
1120104941 14:80483134-80483156 ATGTGGGTTTTTAGGGAAGGTGG - Intronic
1122275827 14:100590359-100590381 ATTTGGGTTAATATTGCAGTTGG - Intergenic
1124494768 15:30179645-30179667 ATTTAGGCTCAAAATGAAGGAGG + Intergenic
1124748801 15:32359000-32359022 ATTTAGGCTCAAAATGAAGGAGG - Intergenic
1125208632 15:37184134-37184156 ATTTGGGGCTATAATGAATTGGG - Intergenic
1127029682 15:54848290-54848312 AATTGGATTTATAAGGAAGATGG - Intergenic
1127180672 15:56413757-56413779 ATCTGTGTATATAATGAAGGTGG - Intronic
1128932791 15:71720536-71720558 ATTTCGTTTTATTATGAATGTGG - Intronic
1131647732 15:94363369-94363391 ATTTGGGCTTAGAATGGAAGCGG + Intronic
1133091495 16:3407953-3407975 AATTGGGTATCTAATGAAGAAGG - Intronic
1134080096 16:11319154-11319176 GTTTGGGTTTATTCTGAAGGTGG + Intronic
1135880109 16:26247254-26247276 ACTTGGGTTTATTATGAAAGGGG + Intergenic
1137351388 16:47716882-47716904 GTTCGGTTTTATAATGAGGGAGG - Intergenic
1138818655 16:60232178-60232200 AGTTGGCTTTATAAAGAATGAGG - Intergenic
1139765063 16:69221246-69221268 ATTTAGGTTTAGAAGGAAGTGGG - Intronic
1140048011 16:71455312-71455334 ATTTGTGGTGATAAGGAAGGTGG - Intronic
1153444934 18:5160836-5160858 TACTTGGTTTATAATGAAGGAGG - Intronic
1153469929 18:5432725-5432747 ATTTGGGTTGAGACTGTAGGAGG - Intronic
1154272198 18:12929917-12929939 GTTTGGGGTTATAATGAATGAGG - Intergenic
1155804580 18:30151596-30151618 ATTTGGGTCTTTCATGAGGGTGG - Intergenic
1157216288 18:45786335-45786357 ATTTGGCATTATAACGAAAGGGG + Intergenic
1157255320 18:46133638-46133660 ATTTGGAGTTATAAAAAAGGTGG + Intergenic
1158075378 18:53522224-53522246 ATTTGGGTTTACAATTAAGATGG + Intronic
1158273847 18:55745218-55745240 ATTTGGGTTGAGAATGTGGGGGG + Intergenic
1159314661 18:66756640-66756662 ATTTAGGTTTCAAATGAAGAGGG + Intergenic
1159438887 18:68452293-68452315 ATTTTAGTTTATAATGAAGAGGG + Intergenic
1159474465 18:68901933-68901955 ATCAGGGTTCAGAATGAAGGAGG - Intronic
1159483941 18:69028688-69028710 ATTTAGGTATATAATAAAGGGGG + Intronic
1162768030 19:12931843-12931865 AGTTGGGATTAGAATGAAGTGGG - Intronic
1164224441 19:23229704-23229726 CTATGGGTTTGTAATGAAGAGGG - Intronic
1164239620 19:23373072-23373094 ATCTGGGTTTGTAGTGAAGAAGG - Intronic
1164519331 19:28966382-28966404 ATTTGAGTTCAAAAGGAAGGTGG + Intergenic
1165389661 19:35531127-35531149 ATTTTGGTGTACAATCAAGGAGG - Intergenic
1167440149 19:49503653-49503675 TTCTGGGTTTATAATGATAGCGG + Intergenic
925721642 2:6834513-6834535 CTTTGGATTTACAATGATGGGGG + Intergenic
925827217 2:7861247-7861269 ATTAGGGAATTTAATGAAGGAGG - Intergenic
925962535 2:9031373-9031395 ATTTGATTTTCTTATGAAGGTGG + Intergenic
926250125 2:11150640-11150662 ATTTTTTTTTTTAATGAAGGTGG + Intergenic
929251852 2:39766452-39766474 ATTTGAGGTTAAAATGAGGGTGG - Intronic
929266190 2:39921085-39921107 ATTTTGGTTTTTTATGGAGGAGG + Intergenic
929349500 2:40931754-40931776 ATATGGATTTATAATCAAGTGGG - Intergenic
929926680 2:46218042-46218064 ATTTTGGGTTCTTATGAAGGTGG + Intergenic
931152788 2:59593753-59593775 ATTTAGGTATATAAACAAGGTGG + Intergenic
934490435 2:94758877-94758899 ATTTAGGCTGAAAATGAAGGCGG + Intergenic
935965127 2:108465254-108465276 ATTTTGGTTCATAGTGGAGGAGG + Intronic
936985386 2:118307401-118307423 ATTTGGCTTTGGAATGAAGTCGG + Intergenic
939013338 2:136872874-136872896 ACTTGGATTTATAAAGTAGGGGG + Intronic
939917175 2:148061122-148061144 TTTTGAGTTTATAATCAAAGAGG + Intronic
940458617 2:153934193-153934215 TTTTAGCTTTATAATTAAGGTGG + Intronic
941714195 2:168746294-168746316 ATTTGGGTTCTTTATGAAAGGGG + Intronic
942083377 2:172422663-172422685 ATGTTTGTTTCTAATGAAGGTGG + Intergenic
942307515 2:174623553-174623575 ATTTGGGTATAAAAAGACGGTGG - Intronic
946093439 2:217250693-217250715 AACTGGGTTTAAAATGAAGGTGG + Intergenic
946476020 2:220007120-220007142 ATTTGGGGTCATTATGAAAGGGG - Intergenic
946942027 2:224779384-224779406 TTTTGTGTTTTTAATTAAGGTGG + Intronic
947694144 2:232169060-232169082 ATGTGGAATTGTAATGAAGGAGG + Intronic
948547557 2:238743532-238743554 ATTTGAGTGGATATTGAAGGAGG + Intergenic
1168994051 20:2119364-2119386 ATTTGGGTTAATGAGGAAGTAGG + Intronic
1169155145 20:3323450-3323472 TTTTGCATTTTTAATGAAGGCGG + Intronic
1169833700 20:9853920-9853942 AATTTCGTTTATAATAAAGGTGG + Intergenic
1171094540 20:22318669-22318691 ATTTGGGTTTTAAATGTAGAGGG + Intergenic
1171214667 20:23343573-23343595 ATTTGGGAAGATAATGTAGGAGG - Intergenic
1172506762 20:35468398-35468420 TTTTTGGATTATAATGAAGTAGG + Intronic
1176662530 21:9651697-9651719 ATTTGGGTATATTTTGAAGTAGG + Intergenic
1178016219 21:28348600-28348622 ATCTGGTTTTAAAATGAAGCAGG + Intergenic
1178610892 21:34078732-34078754 AATGGGGTTTAACATGAAGGTGG + Intronic
1179382049 21:40908792-40908814 ATTTGGGGTTACAACGATGGAGG - Intergenic
1180896297 22:19335758-19335780 ATTTGGGTTTATTATGAAGCCGG - Intronic
1183773285 22:39945448-39945470 ATTTGGGTAAATAAGGAAGGTGG - Intronic
1184570231 22:45318545-45318567 ATTTTGGTTTAAAAACAAGGGGG + Intronic
1185185285 22:49395625-49395647 ATTTGGACTCAAAATGAAGGAGG + Intergenic
950972936 3:17207569-17207591 ATTTGGCCATATAATGAAAGAGG - Intronic
951710112 3:25578156-25578178 GCTTGGGTTGGTAATGAAGGCGG - Intronic
951797679 3:26558885-26558907 ATTTAGGTATATAATGAATTTGG - Intergenic
953266425 3:41393591-41393613 ATTTTGCTTTGTAATGAAGCTGG + Intronic
956602871 3:71041375-71041397 ATGTGGGTTCATTATTAAGGAGG + Exonic
957191308 3:77013338-77013360 AGTTGGGTTTATAATGGAAAAGG + Intronic
957227712 3:77471306-77471328 ATATGGGATTATAAGGAAGCAGG + Intronic
957510140 3:81177336-81177358 ATTCGGGTTTAAAGTGAAGTAGG - Intergenic
958783974 3:98576611-98576633 ATTTAGGTTTATTATGAAATTGG + Intronic
962296795 3:134197242-134197264 ATATGAGTTTATAATGCAGTGGG + Intronic
966064250 3:175797653-175797675 AAATGGGTCTATAATGGAGGAGG + Intronic
971937431 4:33170264-33170286 ATTTGGTTATATTATGAATGTGG - Intergenic
972625914 4:40798522-40798544 ATTTGTGTTTATAACTAAGTTGG + Intronic
973927611 4:55755345-55755367 ATTTATGTTTATATTGAAGCAGG - Intergenic
974364060 4:60922729-60922751 ATTTGGCTCTATACTAAAGGAGG - Intergenic
974647273 4:64711279-64711301 ATTTGGATTTCTAAATAAGGAGG + Intergenic
974754092 4:66181148-66181170 ATTCAGTTTAATAATGAAGGTGG + Intergenic
975895837 4:79089122-79089144 AGTTGTGTCTATAATGAATGAGG + Intergenic
977049183 4:92105030-92105052 ATTTATTTTTAAAATGAAGGGGG - Intergenic
977295823 4:95207826-95207848 ATTTGAGTTTATAGTAAACGAGG - Intronic
977782697 4:100996678-100996700 ATTTGGGTAAATAATCAAGCAGG + Intergenic
977964188 4:103124547-103124569 ATTGAGGTTTGTAATGAAGCAGG - Intronic
979586203 4:122420723-122420745 ATTTGGGTTTCTAATGAAAGTGG - Intronic
981526112 4:145708302-145708324 ATTTGGCTTAAAAATGAAAGGGG - Intronic
982592940 4:157338333-157338355 ATGTGGGTTCATTATGAAGTAGG + Intronic
984383300 4:179023283-179023305 ATTTGAGTTTATAACTAAAGTGG + Intergenic
988072152 5:26306463-26306485 ATTTGGTTTTATAATGGTTGTGG - Intergenic
988150112 5:27365834-27365856 ATTTGGGTAAATATTGAGGGTGG - Intergenic
989825115 5:45844817-45844839 ATTTGTGTTTATTTGGAAGGTGG - Intergenic
992708645 5:79426093-79426115 ATTTGGATTTATTATCAAAGGGG + Intronic
992727941 5:79628384-79628406 AGTTTGGTTTAGAATGAAGTGGG + Intronic
993122241 5:83789818-83789840 ATTTGAGTATGAAATGAAGGTGG - Intergenic
995157163 5:108929575-108929597 AATTGGGCTTACAAAGAAGGAGG + Intronic
995893149 5:116979992-116980014 ATTTGGCTTTTTAAAGAATGTGG + Intergenic
996349540 5:122523185-122523207 ATTTGTATTTATAAGGAAGGAGG - Intergenic
998059875 5:139111545-139111567 ACTTGGGCTTATAGTGATGGAGG - Intronic
998562897 5:143187938-143187960 TTTTGGGTTCAAAATCAAGGGGG - Intronic
1001909792 5:175506142-175506164 ATTTAGGTTTTTAATGAATTTGG - Intronic
1001911420 5:175521641-175521663 GCTTGGGTATATAATGGAGGTGG - Intronic
1004949945 6:20658248-20658270 ATTTGGGTTAATAATGCACAAGG - Intronic
1005626217 6:27664994-27665016 ATTTGCCTTTATAATGAAAAGGG + Intergenic
1006968024 6:38009690-38009712 ATTGGAGTTTAAGATGAAGGAGG - Intronic
1008336699 6:50314766-50314788 TATTTGGTTTAGAATGAAGGGGG - Intergenic
1009597898 6:65759729-65759751 ATTTGTGTTTATATTGAATACGG - Intergenic
1009745986 6:67816503-67816525 ATTTGGTTTTAAAAAGCAGGAGG + Intergenic
1009935304 6:70227031-70227053 ATTTGGGTTTATAATGAAGGTGG + Intronic
1011591877 6:88977721-88977743 ATTTAGGTTTAAAAGGAAGCTGG + Intergenic
1012372608 6:98525902-98525924 ATTGGGGATTAAAATGAAAGGGG - Intergenic
1012704243 6:102500645-102500667 ACTTGGGGTAATAATGAATGTGG - Intergenic
1014316537 6:119872711-119872733 ATTTGGGGTTATAATGTATTTGG - Intergenic
1017814584 6:158007554-158007576 ATCTGGGTATATTTTGAAGGTGG - Intronic
1018158556 6:161014005-161014027 TTTAGAGTTTACAATGAAGGCGG - Intronic
1020404497 7:7816706-7816728 AATTGGGTTGAGAATGAAAGAGG - Intronic
1021651474 7:22837597-22837619 TTTTGGGGTCATAAGGAAGGTGG - Intergenic
1023110466 7:36806097-36806119 ATATGGGTATAAAATGATGGAGG - Intergenic
1023132479 7:37016569-37016591 ATCTGGGTTTATGTTGAAGGAGG - Intronic
1023490630 7:40736518-40736540 ATTTAGGTTTAGACTGATGGTGG + Intronic
1026314645 7:69217749-69217771 ATTTTGGTCTATAATGATTGTGG - Intergenic
1027140853 7:75656279-75656301 AATTTAGTTTATAATAAAGGTGG + Intronic
1028430320 7:90738856-90738878 ATTTTTGTTTATAATTAAAGTGG - Intronic
1028623776 7:92854053-92854075 GTTTGGGTTTCTAATAAAGCTGG + Intergenic
1029229396 7:99053866-99053888 CTTTGGGTTCATAATGACGGGGG - Intronic
1030303276 7:107995387-107995409 ATTTGTGTTTCTACTGGAGGAGG - Intronic
1030785503 7:113656038-113656060 AATTTGGTTTATGATGAAAGTGG + Intergenic
1031120502 7:117716369-117716391 ATTTGGGCTTATGGGGAAGGTGG + Intronic
1033001682 7:137512142-137512164 ATTTGTCTTTATAAAGAAGTAGG + Intronic
1033374783 7:140748015-140748037 ATTTAGTTTTATAATGAACTGGG + Intronic
1035326394 7:158068635-158068657 ATTTCTGTTTAGAATGAAGCAGG - Intronic
1037431963 8:18823053-18823075 ATCTGGTTTTATAAAGAAGGAGG + Intronic
1038659115 8:29481599-29481621 ATTTGGGTTTTTAATTAACCTGG + Intergenic
1039392960 8:37196572-37196594 ATGTCAGTTTGTAATGAAGGCGG - Intergenic
1041929503 8:63271517-63271539 AGTTGAGTCTATAATGAATGTGG - Intergenic
1041943881 8:63420541-63420563 ATTTGGGTTTATAAATATGCTGG + Intergenic
1042064112 8:64855381-64855403 ATTGGGGTTGATAATGAGGCTGG - Intergenic
1042132107 8:65597432-65597454 ATTTGGCTTGATAAGGAAGGGGG + Intergenic
1042497818 8:69475032-69475054 ATTTGGAAATATAATGAAGGTGG + Intronic
1043450386 8:80360418-80360440 GTTTGGTTTTATCCTGAAGGTGG - Intergenic
1043505381 8:80897049-80897071 CTTAGGGTTTATAGTGAAAGGGG + Intergenic
1044270865 8:90241764-90241786 GCTTGGTATTATAATGAAGGTGG + Intergenic
1046535700 8:115506987-115507009 ATTTGGGTTAAAAATAAAGATGG + Intronic
1047461262 8:125067591-125067613 ATTTGAGTTTATACTCAAAGAGG - Exonic
1050007954 9:1154106-1154128 ATTTGATTTTACAATAAAGGTGG + Intergenic
1053171166 9:35885739-35885761 ATTTGGGTGAAAAATAAAGGGGG - Intergenic
1053667565 9:40326827-40326849 ATTTAGGCTGAAAATGAAGGGGG - Intronic
1053917148 9:42951930-42951952 ATTTAGGCTGAAAATGAAGGGGG - Intergenic
1054378708 9:64466854-64466876 ATTTAGGCTGAAAATGAAGGGGG - Intergenic
1054517046 9:66049458-66049480 ATTTAGGCTGAAAATGAAGGGGG + Intergenic
1055206437 9:73736496-73736518 ATTTGGATATATAATTACGGAGG - Intergenic
1055542833 9:77331133-77331155 ATTTTTTTTTATAATGAAAGTGG + Intronic
1056201844 9:84284509-84284531 ATTTGGTTTAAAAATGAAAGGGG - Intronic
1059764508 9:117371078-117371100 TTTTGGGTATATGATGAAGTAGG - Intronic
1186037324 X:5438759-5438781 ATTTGTGTTTAGAATAAGGGTGG - Intergenic
1191900082 X:66031849-66031871 ATTTGGGTTTACAATGAAGTGGG + Intronic
1194444275 X:93968200-93968222 AATTGATTTTATAATGAAGCTGG - Intergenic
1197088314 X:122506458-122506480 ATTTGGCTTTCTATTGAAGAAGG + Intergenic
1198176595 X:134162318-134162340 ATTTCTGTTCATAGTGAAGGAGG - Intergenic
1198467702 X:136918365-136918387 ATTTCAGTTTATCATAAAGGTGG + Intergenic
1198658911 X:138945205-138945227 ATTTTGGTTTATAAAGATGTAGG - Intronic
1199320598 X:146433654-146433676 ATTTTTGTTTCTTATGAAGGTGG + Intergenic