ID: 1009936726

View in Genome Browser
Species Human (GRCh38)
Location 6:70242794-70242816
Sequence TGAAGGAAAAAAACCTAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 1, 2: 1, 3: 25, 4: 362}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009936726_1009936729 -9 Left 1009936726 6:70242794-70242816 CCTACCTAGGTTTTTTTCCTTCA 0: 1
1: 1
2: 1
3: 25
4: 362
Right 1009936729 6:70242808-70242830 TTTCCTTCAGCTAAAGGCATAGG 0: 1
1: 0
2: 2
3: 19
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009936726 Original CRISPR TGAAGGAAAAAAACCTAGGT AGG (reversed) Intronic
902861949 1:19252809-19252831 TAAACAAAAAAAACCTAGCTGGG - Intronic
903359825 1:22769900-22769922 GGAAGGGAAAAAACCGAAGTGGG + Intronic
904392625 1:30195984-30196006 TGAAGGAAAAAGACCTGGGCTGG + Intergenic
904733022 1:32609023-32609045 TGAAAAAAAAAAACCTAGGCTGG + Intronic
906625225 1:47319602-47319624 TGAAGGAAAAAAAGAAAGTTGGG - Intergenic
906813318 1:48851404-48851426 TGAGGGAACAAAACATAGGCAGG + Intronic
907696756 1:56738682-56738704 TTAAGGAAAAAAACCATGTTTGG + Intronic
908086092 1:60635902-60635924 TAAAGGAAAAAGAACTATGTAGG + Intergenic
909154799 1:72060200-72060222 TGAGGGAAAAAAATCAAGATAGG - Intronic
909315757 1:74216060-74216082 TGAAGGAAAAAAACAGAAGATGG - Intronic
909510116 1:76443089-76443111 TGATGGAATAAAACCAAGTTTGG - Intronic
909726476 1:78841896-78841918 TAAAGGGACAAAACCTAGTTTGG - Intergenic
909991107 1:82223698-82223720 TGAAGGAAAAAAAAATAGCCTGG - Intergenic
911282859 1:95953007-95953029 TGAAGGAAAAAAATGTAGCCAGG + Intergenic
912022330 1:105120808-105120830 TTAAGAAAACAAACCTAGGCCGG + Intergenic
912244487 1:107946566-107946588 TGAAGGAAAAAATCCAAAGGGGG + Intronic
912300380 1:108510000-108510022 TGAAGGGAAAAAAGCTATCTTGG - Intergenic
912357321 1:109065545-109065567 GGAAAAAAAAAAACCTATGTTGG + Intronic
912534101 1:110350958-110350980 TGCTGGAAAAAAGCCTAGATAGG + Intergenic
915066715 1:153231091-153231113 TGAAGGAAGAGAAACTAGGAGGG + Intergenic
916153324 1:161818458-161818480 TCAAGGTATAAAATCTAGGTGGG + Intronic
917212584 1:172645428-172645450 TGAAGGGAACAAACCAAGGAAGG + Intergenic
918260013 1:182787244-182787266 TGAAGGAAGGAGACCTAAGTTGG - Intergenic
920731185 1:208487440-208487462 GGAATGTATAAAACCTAGGTAGG + Intergenic
921287026 1:213618075-213618097 TAAAGGAAAAAAAATTAAGTTGG - Intergenic
921316866 1:213900102-213900124 TAAAGGAAAAAAAGCAAAGTTGG + Intergenic
921561872 1:216668517-216668539 TGAAGGACAAAAATCTAGTGAGG + Intronic
922918604 1:229279963-229279985 TGAAGGCAAAATGCCTATGTAGG - Intronic
923027954 1:230221165-230221187 TGAATGAAAAAAAAGTAGGCAGG - Intronic
924622016 1:245670316-245670338 TGAAGGAAAGGAAACTAAGTTGG - Intronic
924656699 1:245979095-245979117 TTAATGAAAGAAACCTAGATAGG + Intronic
1065523798 10:26597311-26597333 AAAAGGAAAAAAAATTAGGTTGG - Intergenic
1066480271 10:35788856-35788878 TAAAGGAAAAGAACATAGGACGG - Intergenic
1068112894 10:52701985-52702007 TGAAGGAAAAAATAGTAGTTTGG - Intergenic
1068574263 10:58666464-58666486 TGAAGGAAAAGAACATAATTAGG - Intronic
1069935421 10:71912397-71912419 TGAAATAAAAAAATCTAGGCCGG - Intergenic
1071840834 10:89469676-89469698 TGATGGAAAAATACCAAGGGTGG + Intronic
1074508055 10:114088563-114088585 TGAAAAAAAAAAAAATAGGTGGG - Intergenic
1076984788 11:227554-227576 TGAAGGAGAAGAACAAAGGTGGG + Intronic
1077681127 11:4241267-4241289 TGAAAAAAAAAAACCCAAGTTGG - Intergenic
1077714204 11:4565312-4565334 GGAAGGCATAAAACCTAGATGGG + Intergenic
1077927605 11:6697402-6697424 TGAATGAAAGAAACCTAGGCCGG - Intergenic
1078478031 11:11650667-11650689 AGAAGGAATAAAAAATAGGTAGG + Intergenic
1078580656 11:12536965-12536987 TGAAGGATAAAAATCCAGTTTGG - Intergenic
1078754304 11:14194147-14194169 GGAAAGACAAAAACCTAGGAAGG - Intronic
1078898796 11:15622312-15622334 GCAAGGAAAAACACCTGGGTTGG - Intergenic
1078978994 11:16510350-16510372 TGAAGGGAAAAAAAATAGGGCGG - Intronic
1079330873 11:19532007-19532029 AGAAAGAAAAAAAATTAGGTTGG + Intronic
1080532156 11:33187408-33187430 TGAAGTAAAATAACTTCGGTGGG + Intergenic
1081070418 11:38603625-38603647 TGAGGGAAAAAAACCACGATGGG + Intergenic
1081280033 11:41198046-41198068 TGAATAAAAAAAAGCTAAGTGGG + Intronic
1082025652 11:47569648-47569670 AGAATGAAAAAAAACTATGTGGG - Intronic
1082130616 11:48484622-48484644 TGATAAAAAAAATCCTAGGTAGG + Intergenic
1082266058 11:50119724-50119746 TGAAGGAAGAAAACCTGTTTGGG + Intergenic
1082290030 11:50358848-50358870 TGAAGGAAGAAAACCTGTTTGGG - Intergenic
1082564123 11:54655494-54655516 TTGATTAAAAAAACCTAGGTAGG + Intergenic
1082920884 11:58492493-58492515 TGAATGAAACAAACACAGGTCGG + Intergenic
1083114455 11:60446434-60446456 TGATTGAAAAAAACACAGGTGGG + Intronic
1084627833 11:70322396-70322418 GGAAGGAAAACAAACTTGGTGGG + Intronic
1085165261 11:74393976-74393998 TGAAAAAAAAAAAACTAGGAAGG + Intronic
1085605496 11:77894105-77894127 TTAAGGAAAAAAACCAAATTAGG + Intronic
1088257922 11:107918202-107918224 TAAAGAAAAAAAATTTAGGTTGG - Intronic
1089049764 11:115536115-115536137 AGAAGGAAAATAACCAAGGAAGG - Intergenic
1089707180 11:120287132-120287154 TAAAGGAAACGAACCTAGTTTGG + Intronic
1090882687 11:130848195-130848217 TATAGGAAAAAAACATAGTTGGG + Intergenic
1092555596 12:9557805-9557827 TGATGGAAAAAAAAATAGATAGG - Intergenic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1094347133 12:29483174-29483196 TGAAGGAAAATGACCAAGATGGG - Intronic
1094392306 12:29964799-29964821 TGCAGGAAAAAACCCTAGAAAGG + Intergenic
1094516502 12:31132870-31132892 TGATGGAAAAAAAAATAGATAGG + Intergenic
1094841341 12:34343880-34343902 GGAAGGAAAAAAACCCAGCGAGG + Intergenic
1094842958 12:34349624-34349646 GGAAGGAAAAAAACCCAGCGAGG - Intergenic
1095326483 12:40900408-40900430 TGTAGGACAAAAATCTATGTGGG - Intronic
1096547369 12:52349912-52349934 TGAAGGAAAAAAATCCAAATGGG + Intergenic
1098206888 12:68120253-68120275 TCAAGGAGAAAAATCTAGGTAGG - Intergenic
1098708452 12:73722224-73722246 TGAAGGAAAAATACCTTAGTAGG + Intergenic
1099853255 12:88131959-88131981 TGAGGGACATAAACCTAGGCCGG - Intronic
1100038747 12:90284543-90284565 CAAAGGAACAAAAACTAGGTTGG + Intergenic
1100085283 12:90902860-90902882 TGAAAGAAAAATATCTAGCTTGG - Intergenic
1100729304 12:97446384-97446406 TGAAGGAAAAAGTCTTAGATGGG - Intergenic
1101003058 12:100375369-100375391 GGAAGGAAGAAAAGCTAGGTGGG + Intronic
1101451782 12:104786388-104786410 TGTATGAGAAACACCTAGGTAGG - Intergenic
1104480488 12:129103521-129103543 TGAAGGAACAAAGAGTAGGTTGG - Intronic
1105258280 13:18759661-18759683 GGAAGGAAAAACAAGTAGGTAGG - Intergenic
1105499710 13:20961193-20961215 AGAAAGAAAAAAACCTCTGTAGG + Intergenic
1105542746 13:21328854-21328876 TGAAGGAAAAAAATGTGGGATGG + Intergenic
1106180614 13:27366198-27366220 GGAAGGAGAAAAACCAAGATCGG - Intergenic
1106737135 13:32599064-32599086 TAAAGGAAAAAAACTGAGGCTGG - Intronic
1106818852 13:33440727-33440749 TCAAGGAAAGAGACCTAAGTTGG - Intergenic
1107461458 13:40607451-40607473 TGAAGGAAGAAACCCCAAGTGGG - Intronic
1109096128 13:58118866-58118888 TGAAGGAGAAAAATCTGGTTTGG - Intergenic
1109553938 13:63945067-63945089 TGAAGGAAAGCACCCTAGCTGGG + Intergenic
1109567154 13:64132064-64132086 GGAAGGAAATAAACCTGGCTTGG + Intergenic
1110332379 13:74287682-74287704 TGAAGGAAATAAACCGAAGCAGG - Intergenic
1110447882 13:75607471-75607493 TTAAGAAAAAAAACCAGGGTTGG + Intergenic
1111882967 13:93981650-93981672 GGAAAGAAAAAAGCTTAGGTTGG - Intronic
1112759489 13:102677898-102677920 TGAATGAAAGGAACTTAGGTTGG + Intronic
1112915184 13:104539508-104539530 GGAAGGTAGAAAACTTAGGTAGG + Intergenic
1112972865 13:105282366-105282388 TTAAAGAAAAATAACTAGGTTGG - Intergenic
1113182664 13:107649117-107649139 TGAAGAAATAAAACATAGGTTGG - Intronic
1114488578 14:23080617-23080639 TGAGGGACAAAAATCTAGGGAGG - Exonic
1114582202 14:23772344-23772366 TGAAGGGAGAAAAACCAGGTGGG + Intergenic
1115022097 14:28694209-28694231 TTAAGAAAACAAACCTAGCTGGG - Intergenic
1115207508 14:30925546-30925568 TAAAGAAAAAAAATCAAGGTTGG + Intronic
1115796133 14:36937644-36937666 TGAAGGAAACAAACAAAGATCGG + Intronic
1116797771 14:49410424-49410446 TGAAGGTAAAAAGGCTAGCTGGG - Intergenic
1117604261 14:57410020-57410042 TGAATGAAAAAAATGTAGGGTGG + Exonic
1117795199 14:59386615-59386637 TGAAAGAAAAAGACATAGATGGG - Intergenic
1118457846 14:65960913-65960935 TGAAGGAAAAGAGCTCAGGTTGG + Intronic
1119330621 14:73790706-73790728 TCAGGGAAAAAAACCAAGGAGGG + Intergenic
1120136089 14:80871178-80871200 GGAACGAAAGAAACCCAGGTAGG + Intronic
1120317074 14:82908102-82908124 TGAAGGTAAAAAACATATGCTGG + Intergenic
1121030602 14:90655293-90655315 TTAAGGAGAAAAAGCAAGGTAGG - Intronic
1122209115 14:100163593-100163615 TGAAGGAAACAAGGCTGGGTAGG - Intergenic
1124199690 15:27668412-27668434 GGAAGGAAAAAAAGCTAAGAGGG - Intergenic
1125046246 15:35244715-35244737 TGAAAGAAGAAAACTTAGGATGG + Intronic
1125084522 15:35714518-35714540 TGAAGGAATAAAAACAAGGGGGG - Intergenic
1125796223 15:42405926-42405948 AAAAAGAAAAAAACCAAGGTAGG + Exonic
1125844356 15:42837699-42837721 TTAAGGAAATAAAACTAGGCTGG + Intronic
1125900242 15:43339587-43339609 AGAAGAAAAAAAGGCTAGGTTGG - Intronic
1125994921 15:44149965-44149987 TGCAGGAAAAAAATCTAACTTGG - Intronic
1126070096 15:44858707-44858729 GGGAGGAAAAAACCCTTGGTTGG - Intergenic
1126915051 15:53457138-53457160 TGAAGGAAACAAACCAACGGAGG - Intergenic
1127383448 15:58448939-58448961 TGAAGGACAAAAACCAGGCTTGG + Intronic
1127662295 15:61111379-61111401 AGGAGGAAGAAAACCTGGGTAGG + Intronic
1129985380 15:79915377-79915399 TGTAGGAAAAAAAAGTGGGTGGG - Intronic
1130049231 15:80469192-80469214 TGAAGGTAAAAAGCCTGGGTTGG + Intronic
1130073595 15:80669811-80669833 TGAAAGAAAAAAATCTTGGAGGG - Intergenic
1130755693 15:86760678-86760700 CAAAGGAAAGAAATCTAGGTGGG - Intronic
1132122253 15:99186317-99186339 TGAAGTCAAAAAATCTGGGTTGG - Intronic
1132396195 15:101476499-101476521 TTAGTGAAGAAAACCTAGGTAGG + Intronic
1132780511 16:1621894-1621916 TGATGTAAACAAAACTAGGTGGG - Intronic
1133333849 16:4993579-4993601 TGAAGGAAACAACCCTATTTAGG + Intronic
1134214979 16:12310310-12310332 TCTAGGATAAAAACCTAGGAGGG - Intronic
1135719056 16:24799214-24799236 CGAAGGAAAAAAACCTATAAAGG + Intronic
1136128777 16:28205276-28205298 TGAAGGAAATAAACATTTGTTGG - Intronic
1136560300 16:31035023-31035045 AGAATGAGAAAAACCCAGGTGGG + Exonic
1136948932 16:34691358-34691380 TGAAGGAAGAAAACGAGGGTGGG + Intergenic
1138604078 16:58076383-58076405 TGAAGGAAATAAACTGAGGAAGG + Intergenic
1139557395 16:67721074-67721096 TGGAGCAAAAGAACCCAGGTAGG - Intergenic
1141852182 16:86653955-86653977 GAAAGGAAAAAAACCGAGGTAGG - Intergenic
1142257615 16:89022340-89022362 AGAAGGCACAAAACCAAGGTTGG - Intergenic
1143333085 17:6152166-6152188 TAAAAGAACAAAACTTAGGTGGG - Intergenic
1145154756 17:20535932-20535954 TGGAGAAAAAAAACCAATGTTGG - Intergenic
1146470527 17:33120878-33120900 TGAAGGAAAAAAAGCTAATATGG + Intronic
1146780758 17:35669596-35669618 TGAAAGAAAATAACCCTGGTAGG - Intronic
1147283638 17:39383322-39383344 TGGAGAAGAAAAACCTTGGTCGG + Intronic
1147763355 17:42815776-42815798 TGAATGAAAGAAACCTAGTTGGG + Intronic
1149152529 17:53585835-53585857 TGAAAGAAAAACAAGTAGGTCGG + Intergenic
1149203662 17:54217721-54217743 TTCAGGAAAAAATCCTAGATTGG - Intergenic
1149316416 17:55443051-55443073 TGAAGTCAGAAAACCAAGGTTGG - Intergenic
1153857242 18:9162021-9162043 TGAAGGAAAAAAAATTGGCTGGG - Intronic
1153976498 18:10272639-10272661 TGAAGGAAAAAGACCCATCTGGG + Intergenic
1155381932 18:25232244-25232266 TGCAGGTGAAATACCTAGGTAGG - Intronic
1155525813 18:26715359-26715381 GGAAGAAAAAAAACCTCTGTTGG + Intergenic
1156009522 18:32480410-32480432 TGTAGGAAAAGAACCTGTGTGGG - Intergenic
1157087884 18:44600304-44600326 GGAAGGAAAGAAACTTAGGAGGG + Intergenic
1157115066 18:44854763-44854785 TGGAGGAGAAAAACCAATGTGGG - Intronic
1157726295 18:49966548-49966570 TGAATTAATAAAACCTAGGTGGG + Intronic
1157968943 18:52243122-52243144 GGAAGAAAAAAAAACTGGGTTGG - Intergenic
1158632614 18:59129304-59129326 TGAAGGAAAAACATCTCAGTGGG - Intergenic
1158739516 18:60123894-60123916 TGAAGAAAAAAAAAATAGGGGGG - Intergenic
1158978934 18:62739694-62739716 TGAAGGAGTTAACCCTAGGTGGG + Intronic
1160661750 19:304372-304394 TGGAGGAAAAAAACCAAGAGAGG + Intergenic
1165294161 19:34912693-34912715 TAAAAAAAAAAAACCTAAGTTGG - Intergenic
1166284412 19:41815131-41815153 AGAAAGAAAAAGACCAAGGTAGG + Intergenic
1166741085 19:45115216-45115238 GGAAGGAAATAAACCAAGGCTGG + Intronic
1168034854 19:53711240-53711262 TGAATCCAAAAGACCTAGGTTGG - Intergenic
926101484 2:10121238-10121260 TGAGAGAAACAGACCTAGGTGGG + Intergenic
927087722 2:19687996-19688018 TGAAGGAAATAAAAATAGGTAGG + Intergenic
927359008 2:22209806-22209828 TGAAGGAAGAGACCCTAGGCAGG + Intergenic
929091951 2:38226423-38226445 TGAAGGAAAATTATATAGGTCGG + Intergenic
930053548 2:47235295-47235317 GGCAGGAAATAAACCTAGGAAGG + Intergenic
930377205 2:50583042-50583064 AGAAAAAAAAAAAACTAGGTGGG - Intronic
930725381 2:54676653-54676675 TGCAGGAAAAGAATCTAGGTGGG - Intergenic
930778347 2:55197279-55197301 TGAAGGAAAAAAAACAAGCCTGG + Intronic
930851329 2:55964179-55964201 TGAAGGAAAAAAATGAACGTAGG - Intergenic
931184443 2:59936439-59936461 AGAATGAAAAAATCCTAGGAAGG + Intergenic
933932140 2:87163764-87163786 TTAAGTTAAAAAACCTAAGTTGG - Intergenic
935817919 2:106864583-106864605 TAAATGAAAAAAACTTATGTTGG - Intronic
935834246 2:107033274-107033296 TTAAGGAAACAAAACTATGTAGG - Intergenic
935924019 2:108047741-108047763 AGAAGGAAAAAAACTCAAGTAGG + Intergenic
936341525 2:111637934-111637956 TGAAGGAAAAGAACTTCAGTGGG + Intergenic
937179370 2:119976422-119976444 TTAAGTAAAAAAAGCAAGGTAGG - Intronic
938925257 2:136034251-136034273 AAAACGAAAAAAACATAGGTAGG + Intergenic
939041316 2:137192130-137192152 TGAAAGAAAAAAATCAAAGTGGG + Intronic
940135607 2:150432621-150432643 TGAAGGAAGAAATCCAAAGTGGG - Intergenic
942331298 2:174827633-174827655 TGAAGGAAGACAGACTAGGTAGG + Intronic
945015649 2:205512569-205512591 TGAATGAAAAAAACCAACGAAGG - Intronic
946226695 2:218267653-218267675 TGAAGGACAGAGCCCTAGGTGGG - Intronic
946246819 2:218392625-218392647 TGAAGGAAACAAAGCTGAGTGGG - Intronic
946340952 2:219068164-219068186 TAAAGAAAATAAAGCTAGGTGGG + Intergenic
946609022 2:221438174-221438196 TGCAGAAAAAAAAAATAGGTAGG - Intronic
946906387 2:224420827-224420849 TTAAGGAAAAGAACCTAGTGGGG + Intergenic
947123424 2:226841291-226841313 TGAAGAAAAAAAAATTAGCTGGG - Intronic
1169600558 20:7255374-7255396 AGAAGGAAAAAAACAAAGGAAGG + Intergenic
1169976940 20:11339878-11339900 TCCAGGAAACAAATCTAGGTGGG - Intergenic
1170408423 20:16063665-16063687 TGCAGGAAAAAGACCTGGGGAGG + Intergenic
1170409609 20:16074527-16074549 TGAAAGAGAAAAATCTAAGTAGG - Intergenic
1170468600 20:16645741-16645763 TGAAGTAAAAAAACAAATGTGGG - Intergenic
1170837711 20:19899141-19899163 TTAAGGCAAAAATCCTTGGTTGG - Intronic
1173509095 20:43612184-43612206 TGGAGGAAGAAAAAGTAGGTGGG - Intronic
1173527877 20:43746801-43746823 TGAAGGGAAAAAAAAAAGGTGGG + Intergenic
1173739404 20:45386719-45386741 TGAAAGAAAAAAAATTAGCTGGG - Intronic
1174667803 20:52276518-52276540 TGGAGGAAAGAAAGCCAGGTTGG - Intergenic
1176156196 20:63622536-63622558 TGGAGGAAAAGAAGCTAGGGTGG - Intronic
1177209787 21:18056843-18056865 TGAAGGAAAAAACCATGGGGAGG - Intronic
1177385560 21:20405370-20405392 TGAAGGAGAAAATCCTAGAGAGG - Intergenic
1177603935 21:23354902-23354924 TGAATGAACCAAACATAGGTCGG + Intergenic
1178453221 21:32723940-32723962 TGAAGGAAGAAGACCTGAGTAGG + Intronic
1179155621 21:38848584-38848606 TAAAGCAAAGAAATCTAGGTAGG - Intergenic
1179167360 21:38945193-38945215 TGGAGCAAAGAAACCGAGGTAGG + Intergenic
1180085248 21:45505334-45505356 TGCAGGAGAGAAACCAAGGTGGG - Intronic
1180747527 22:18100978-18101000 TGAAGGCAAAAATGCTAAGTCGG - Exonic
1181748430 22:24972114-24972136 TGAAGGAAAAATGGGTAGGTAGG + Intronic
949185434 3:1186539-1186561 CGAAAGAAAAACACCTAAGTGGG - Intronic
949383618 3:3473744-3473766 AGAAGGAAGAAAAACTAGTTTGG - Intergenic
949430683 3:3972376-3972398 TGAAGGTTAAAAGACTAGGTTGG - Intronic
951356001 3:21667320-21667342 TGAAAGTACAAAAACTAGGTGGG - Intronic
951519155 3:23595091-23595113 TTAAGGAAAAGAATCTTGGTTGG - Intergenic
951613076 3:24513042-24513064 AGAGGGAAAAAAACGTAGTTAGG + Intergenic
952366565 3:32680121-32680143 TCAAGGAAAAAAATCTATCTTGG - Intergenic
955131001 3:56168461-56168483 TGAATGAAATAAACCTAGGTAGG + Intronic
955689897 3:61580706-61580728 TAAGGGAAAAAAACCTAACTGGG + Intronic
955789738 3:62576259-62576281 TAAAGGAGAAACACCTAAGTGGG + Intronic
956607278 3:71085450-71085472 TGAAGTAAAAAAAGCTAAGTGGG - Intronic
957592214 3:82214232-82214254 TGAGGACAAAAAACCGAGGTGGG + Intergenic
957594485 3:82244675-82244697 TGGAGTAAATAAAGCTAGGTAGG - Intergenic
958412231 3:93832141-93832163 TGAAGGAAAATAACAGAGGAAGG - Intergenic
960654896 3:119991803-119991825 ACAAGGAAAAAAACCGAGCTTGG + Intronic
961621377 3:128227505-128227527 TGAAGCAAAGAAACCAAGGCAGG - Intronic
962467643 3:135675057-135675079 TGAAGGACACAAATCTAGGGTGG + Intergenic
962824355 3:139086500-139086522 AGAAAAAAAAAAACCTGGGTAGG - Intronic
963209787 3:142676133-142676155 TGAAAGGAGAAAACCTTGGTAGG - Intronic
964252509 3:154734982-154735004 AGAAGAAGAAACACCTAGGTGGG + Intergenic
964308679 3:155369084-155369106 AGAAGGAAAAAAACATGGATTGG - Intergenic
964755169 3:160085877-160085899 CAAGGGAAAAAAACCTAGGGAGG - Intergenic
965153473 3:165013560-165013582 AGAAGGAAAAAAATGTTGGTAGG - Intronic
965538433 3:169848829-169848851 TGAAGGAAAGAAACCCCAGTTGG - Intronic
965767941 3:172151462-172151484 TGTAGGAAAAAAAAAGAGGTTGG - Intronic
965959686 3:174414131-174414153 TGAAACAAATAAACCTAAGTAGG + Intergenic
967675554 3:192294534-192294556 AGAAACAAAACAACCTAGGTTGG + Intronic
968094776 3:195921152-195921174 TGAAGGAAAAACACCAATCTCGG - Intergenic
970694717 4:18663865-18663887 AGAAGGAGAAAAACCTAGTGGGG + Intergenic
970988301 4:22183822-22183844 AGAAGGAAAAAAACCTAAACTGG - Intergenic
971170536 4:24228661-24228683 AAAAGAAAAAAAACCCAGGTAGG + Intergenic
971654142 4:29320716-29320738 TGAGGGAAAAATACCTGGGCAGG - Intergenic
973178345 4:47235988-47236010 ATAAGAAAAAAAACCTAGGATGG - Intronic
974368499 4:60984462-60984484 TGAAGCAAACAAAAGTAGGTGGG + Intergenic
974424117 4:61718782-61718804 TTAAGGAAAAAAAAATAGCTGGG + Intronic
975230514 4:71927338-71927360 TGAAGTAACAGATCCTAGGTGGG + Intergenic
975632072 4:76414199-76414221 TAAAGGAAAAAAACTTAGCTGGG - Intronic
976639786 4:87326174-87326196 TTAAGGAAAAAAATCAAGGGGGG - Intergenic
977850097 4:101817115-101817137 TGAAGGAAACAAACATATTTGGG - Intronic
979202393 4:117993965-117993987 TGTGGGAAAAAACCCTAGGATGG - Intergenic
979460064 4:120971857-120971879 TGTAAGAATCAAACCTAGGTGGG + Intergenic
980886678 4:138769970-138769992 GGAAGGAAAAAGACATTGGTGGG - Intergenic
981574788 4:146193248-146193270 AGAAGGAAAAAAACAAAGATGGG - Intronic
983408498 4:167364847-167364869 GGAAGGAATAAGAACTAGGTTGG - Intergenic
983900379 4:173127260-173127282 GGAAGGAAAAAAAATTAGCTGGG - Intergenic
984121196 4:175746974-175746996 TTAAAGAAAGAAACCTAGGCTGG + Intronic
984658216 4:182343104-182343126 TGAATAAACACAACCTAGGTGGG - Intronic
986185637 5:5433936-5433958 TGAAAAAAAAAAACCTAAGTAGG + Intronic
987438889 5:17932023-17932045 TGAAGGAAAAAAAACCAATTGGG + Intergenic
988336624 5:29915930-29915952 TGATGGAAAAAAACCTACCAAGG + Intergenic
989507946 5:42249032-42249054 TAAAGAAAAAAAAAGTAGGTGGG + Intergenic
990122620 5:52473911-52473933 GGAAGGAAAAAAAGGTAGGATGG - Intergenic
991236282 5:64402384-64402406 TGAAAGAAAAAAATCAAAGTTGG + Intergenic
991665089 5:68991756-68991778 TGAAGGAAAAAAAGCAAATTAGG + Intergenic
992082650 5:73249543-73249565 TGAAAGAAAAAAACAAAGGTAGG - Intergenic
992420898 5:76603399-76603421 TGAAGGAAAAAGGCTTAGTTAGG - Intronic
993421564 5:87708184-87708206 TGCAGGAAAAACACCAAGGGAGG - Intergenic
993997119 5:94736321-94736343 TGTATGAAAAAAAACTAGCTGGG + Intronic
994189640 5:96855466-96855488 AAAAGAAAAAAAACCCAGGTGGG + Intronic
995124374 5:108565515-108565537 TGAAGGAAAAAAAGATAAGCCGG - Intergenic
995139824 5:108722615-108722637 TGAAAGAAAAAAAATTAGCTGGG + Intergenic
995478502 5:112571863-112571885 GGAAGGAAAAAAGCCAAGATGGG + Intergenic
995750951 5:115452745-115452767 TGTAGGAAAAAGGCCTAGATAGG - Intergenic
995775482 5:115720513-115720535 TAAAAGAAAACAACCGAGGTAGG + Intergenic
996174199 5:120334571-120334593 AGAAAGAAAAAAAGCTAGGAAGG - Intergenic
996322873 5:122239099-122239121 TGAAGGAAAAAAACCAGTGATGG + Intergenic
996543078 5:124649652-124649674 TGGAGGAACAAAACGTACGTGGG - Exonic
996962476 5:129268230-129268252 TGAAGGAAAAAAACTTATCCTGG - Intergenic
998542073 5:142992294-142992316 TGGAGGAATAAAATCAAGGTTGG - Intronic
998622857 5:143813263-143813285 TGAAGGAAAAAAGGGAAGGTCGG - Intronic
999537627 5:152534963-152534985 AGAGGGGAAAAAACCAAGGTGGG + Intergenic
1000663676 5:163968030-163968052 TGAAGGAAAAAAAGAAAAGTAGG - Intergenic
1002388813 5:178893061-178893083 TGAAAGAAAAAAACAAAGCTAGG + Intergenic
1004620597 6:17327147-17327169 TGAAGGAAAAAGAAAAAGGTGGG + Intergenic
1005186968 6:23173460-23173482 TGAGGGAAAGAATCATAGGTGGG - Intergenic
1005276829 6:24228718-24228740 TTAAGGAAAGAAACAGAGGTAGG - Intronic
1006106391 6:31719387-31719409 GGAAGGAAGGAAGCCTAGGTGGG - Intronic
1006720504 6:36147154-36147176 AGAAGGTAAAGAACCCAGGTGGG - Intergenic
1008153334 6:47983160-47983182 TGAAGGGAAGAAAACTATGTTGG + Intronic
1008232470 6:49000229-49000251 TGAAAGAGAAAAACCAAGTTTGG + Intergenic
1009936726 6:70242794-70242816 TGAAGGAAAAAAACCTAGGTAGG - Intronic
1010298767 6:74232687-74232709 TGATGAAAAAAAATCTAGGCTGG - Intergenic
1011050820 6:83147969-83147991 TGAAGGAAAAAGAACTAAGAGGG + Intronic
1011641135 6:89417532-89417554 TGAAGGAAAAAAACAGAGGGAGG + Intergenic
1013048593 6:106511100-106511122 AGAAGGTAAAAAACCTAGAGAGG + Intergenic
1013212294 6:107997973-107997995 AGAAGGAAAAACACCTAGGATGG + Intergenic
1014687823 6:124525533-124525555 TGATGGAAAAAAACTTATATGGG + Intronic
1015342317 6:132115322-132115344 TGAAGGAGAAAGAACTAGGCTGG - Intergenic
1015831508 6:137374803-137374825 TGAAGGAATAAAAAATAGATAGG - Intergenic
1017095635 6:150802554-150802576 TGAAGAAAAAAAACAGTGGTTGG + Intronic
1017366077 6:153640145-153640167 TTAAGGAAAAAAAAACAGGTAGG + Intergenic
1018019460 6:159745916-159745938 GGAATGAAAAAAATCTAGGGAGG + Intronic
1018308208 6:162480470-162480492 TGAAGGAGAAAAACTTACATGGG + Intronic
1018881465 6:167886459-167886481 TGAAGGAAAAATACCTGAGCTGG + Intronic
1019255244 7:45701-45723 TGAAGAAAATAAAACCAGGTGGG + Intergenic
1020612018 7:10409938-10409960 AGAAGGAAAAAAAGAAAGGTAGG - Intergenic
1021508929 7:21414319-21414341 TGAAGTAAAAAAAATTAGCTGGG + Intergenic
1023179223 7:37464764-37464786 TGAAGGTAAAAATGCTAAGTAGG + Intergenic
1025043973 7:55675272-55675294 TGTAGTAAAAAAATCTAGCTGGG - Intergenic
1027749284 7:82121210-82121232 AGAAATTAAAAAACCTAGGTGGG - Intronic
1028528469 7:91811759-91811781 TGAAGGAAAAAAAAATATTTTGG + Intronic
1028661875 7:93287024-93287046 TTAAGGAAAAAAGGCAAGGTGGG - Intronic
1029698068 7:102227652-102227674 TGACGGACAACAACCTCGGTAGG + Exonic
1029877100 7:103765678-103765700 TGAAGGACAAAGACCAAGTTTGG - Intronic
1030323024 7:108189151-108189173 GGAAAGAAAGAGACCTAGGTTGG + Intronic
1031244546 7:119292507-119292529 TGGAGGTTAAAAACTTAGGTAGG + Intergenic
1032506013 7:132435280-132435302 GGAAAGAAAATAACCAAGGTGGG + Intronic
1033555224 7:142483092-142483114 TGAAGGAGTGAAACCTGGGTGGG - Intergenic
1033559830 7:142520628-142520650 TGAAGGAGTGAAACCTGGGTGGG - Intergenic
1033872968 7:145779648-145779670 AAAAGGATAAAAACCTAAGTAGG - Intergenic
1036105683 8:5836132-5836154 TGAAGTATAAAAACGTAAGTGGG + Intergenic
1038460576 8:27712996-27713018 TGAAGGAAAATATCCTTGTTTGG - Intergenic
1038761823 8:30391461-30391483 TCAAAGAAAAAAACTTAGGAAGG + Intronic
1039386090 8:37136851-37136873 TGAAGGAAAAAAATCTATTCTGG + Intergenic
1039600118 8:38829436-38829458 AGATGGAAAAAAACCAAGGCAGG - Intronic
1040738756 8:50546035-50546057 TGAAGCAGAAAAAAGTAGGTAGG + Intronic
1041226459 8:55705092-55705114 TGAAGGAAAAAAACATAAATAGG + Intronic
1042253993 8:66784685-66784707 TGAAGGAAAAAATCCTTTTTAGG + Intronic
1042850331 8:73210313-73210335 TGAAGGAAAAAAACATTGGAAGG + Intergenic
1043159182 8:76824487-76824509 GCAAGGAAAAAAACCTACCTAGG + Intronic
1043654963 8:82651699-82651721 TGAATTAATAAAACTTAGGTTGG + Intergenic
1044045812 8:87430369-87430391 GCAAGGAGAAAATCCTAGGTTGG + Intronic
1044300524 8:90577929-90577951 TAAAGCAAAAAAACCTAGCTGGG + Intergenic
1045158640 8:99510500-99510522 TCAAACAAAAAAACATAGGTTGG - Intronic
1045370933 8:101522007-101522029 TGGAGGAAGAAAACTTTGGTAGG + Intronic
1045553031 8:103189680-103189702 TGGAGAAATAACACCTAGGTGGG + Intronic
1045764903 8:105655919-105655941 TGAATGAAAAAAGCCAATGTGGG - Intronic
1046663297 8:116972508-116972530 TGAAGGTGAAAAACCTACATCGG - Intronic
1046672798 8:117075795-117075817 TGCAGGCAAAAAACCTTGATAGG + Intronic
1048033474 8:130654605-130654627 TGAAGAAAAATAACCTATCTTGG + Intergenic
1048054830 8:130853283-130853305 TTAAGGAAGAAAGCCCAGGTTGG + Intronic
1048211355 8:132456986-132457008 TGAAGCAAAAATACATATGTAGG - Intronic
1048342969 8:133555025-133555047 TGAAGTAGAAAAACCCAAGTAGG - Intronic
1048459335 8:134607636-134607658 AGAATGAAATAGACCTAGGTTGG - Intronic
1048692440 8:136982845-136982867 TGATGAAATAAAACCTAAGTGGG - Intergenic
1049128660 8:140816020-140816042 TGAAGGAAAAAATTGTATGTGGG + Intronic
1049303809 8:141886653-141886675 TCAAGGAGAAAAACCCAGGGTGG + Intergenic
1050657845 9:7848497-7848519 TGAAACAAAAAAACCTGGATGGG + Intronic
1052463360 9:28796020-28796042 TTCAGGAAAAAAACCTGTGTGGG + Intergenic
1052581849 9:30367025-30367047 TCCTAGAAAAAAACCTAGGTAGG - Intergenic
1052998354 9:34563848-34563870 GGATGGAGAAAAACCAAGGTAGG - Intronic
1053345782 9:37377317-37377339 AGAAGGTAAAATACATAGGTAGG + Intergenic
1053625586 9:39867625-39867647 AAAAGGAAAAAATCCTGGGTTGG + Intergenic
1054218302 9:62383076-62383098 AAAAGGAAAAAATCCTGGGTTGG - Intergenic
1054812838 9:69448161-69448183 TGAAGGAATAAAACCTAGGTAGG - Intronic
1054918857 9:70521876-70521898 TGGGGGAAAAATACCTTGGTGGG + Intergenic
1055842343 9:80519888-80519910 AGAAGGAAGAAAAGCTGGGTGGG - Intergenic
1058476081 9:105334367-105334389 TAAAGGAAAAAAAAATAAGTAGG - Intronic
1058575608 9:106397751-106397773 TGAAGGATAAAATGCTAAGTTGG + Intergenic
1058739204 9:107925568-107925590 TGTTGGATAAAAACCCAGGTTGG + Intergenic
1058801036 9:108544630-108544652 TAATGGAAAAAGACCTAGCTTGG - Intergenic
1059177014 9:112176338-112176360 TGAAAAAAAAAAAATTAGGTGGG + Intergenic
1059953849 9:119495754-119495776 TGAAGGAAAAAATTCTATGAAGG + Intronic
1060606108 9:124915527-124915549 TGAAGGAAAAAAAGGCATGTTGG - Intronic
1061068371 9:128293505-128293527 TAAATTAAAAAAAGCTAGGTGGG - Intergenic
1187569525 X:20486893-20486915 TGGAGGCAGAAAACCAAGGTGGG + Intergenic
1187950924 X:24469491-24469513 TTAAAAAAAAAAACTTAGGTGGG + Intronic
1188296310 X:28454061-28454083 TGAAGAAAAAATATCTAGATTGG - Intergenic
1188355416 X:29184413-29184435 TGAAGAAAACAAACCTTGGCTGG - Intronic
1188987287 X:36779207-36779229 GGATGGAAAAAAATCTAGCTAGG - Intergenic
1189480176 X:41386315-41386337 GGAAGAAAAAAAAACAAGGTGGG + Intergenic
1189907432 X:45776054-45776076 TAAAGGAAAAAATCATGGGTAGG - Intergenic
1190937767 X:55012110-55012132 TCAAGGAAGACAAGCTAGGTAGG - Intronic
1192314522 X:70041625-70041647 GGAAGGAAAAAAAAGGAGGTGGG + Intronic
1193996500 X:88371849-88371871 TGAAGGAATAAAAGCTTGCTGGG - Intergenic
1194414054 X:93589128-93589150 TAAAGAAAAAAAACCCAGGCTGG + Intergenic
1195064033 X:101223160-101223182 TGAAGGAAAAAAAATTAGCTGGG - Intronic
1197634519 X:128900193-128900215 TGAAGGGCAACATCCTAGGTGGG - Intergenic
1198250284 X:134873367-134873389 TGGATGAAAAAAAGCTATGTGGG - Intergenic
1198993626 X:142546714-142546736 TTAAGCAAAAAGACTTAGGTTGG - Intergenic
1199479341 X:148280750-148280772 TGAAGAAAAAAAAACTGGGTAGG - Intergenic
1199925888 X:152463589-152463611 TGAAGCAAAAATACATAGGTGGG + Intergenic
1200130066 X:153837226-153837248 TGCTGAAAAAAAACCTAAGTGGG - Intergenic
1200806411 Y:7437797-7437819 AGAAAGAAAAAAAATTAGGTAGG - Intergenic
1200897082 Y:8387202-8387224 TTTGGGGAAAAAACCTAGGTGGG + Intergenic