ID: 1009937754

View in Genome Browser
Species Human (GRCh38)
Location 6:70253614-70253636
Sequence GGGCATGACTTTACTATATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 59}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009937749_1009937754 20 Left 1009937749 6:70253571-70253593 CCAAATTCTGCACAGTCATTTAT 0: 1
1: 0
2: 0
3: 26
4: 225
Right 1009937754 6:70253614-70253636 GGGCATGACTTTACTATATCTGG 0: 1
1: 0
2: 0
3: 4
4: 59
1009937752_1009937754 -10 Left 1009937752 6:70253601-70253623 CCCACAGTTTAGAGGGCATGACT 0: 1
1: 0
2: 1
3: 6
4: 83
Right 1009937754 6:70253614-70253636 GGGCATGACTTTACTATATCTGG 0: 1
1: 0
2: 0
3: 4
4: 59
1009937747_1009937754 28 Left 1009937747 6:70253563-70253585 CCTAGTTCCCAAATTCTGCACAG 0: 1
1: 0
2: 4
3: 15
4: 185
Right 1009937754 6:70253614-70253636 GGGCATGACTTTACTATATCTGG 0: 1
1: 0
2: 0
3: 4
4: 59
1009937748_1009937754 21 Left 1009937748 6:70253570-70253592 CCCAAATTCTGCACAGTCATTTA 0: 1
1: 0
2: 1
3: 15
4: 246
Right 1009937754 6:70253614-70253636 GGGCATGACTTTACTATATCTGG 0: 1
1: 0
2: 0
3: 4
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009937754 Original CRISPR GGGCATGACTTTACTATATC TGG Intronic
905328120 1:37172502-37172524 GGGCATGACTTTTCCCTCTCTGG - Intergenic
912902107 1:113662393-113662415 GAACATAAATTTACTATATCTGG + Intronic
918947102 1:191081094-191081116 GGGCATGATTTTTGTATATCGGG - Intergenic
1072382031 10:94882717-94882739 GGGAATGACCCCACTATATCAGG + Intergenic
1073916952 10:108416771-108416793 GGGCTTGAGTTTACTATTTGTGG - Intergenic
1077925885 11:6681839-6681861 AGCCATGAATTTACTATCTCAGG + Exonic
1078957238 11:16213209-16213231 TGGCATGGGTTTAGTATATCAGG + Intronic
1082647322 11:55744006-55744028 GGGTATGACTTTAAAATATCTGG - Intergenic
1084175845 11:67421681-67421703 GGGCATCACTTTACAGAATCTGG + Intronic
1087432509 11:98071359-98071381 GGACATTACTGTACAATATCTGG - Intergenic
1088388320 11:109284692-109284714 GGGGATGTCATTTCTATATCTGG - Intergenic
1106570931 13:30927157-30927179 GGGCATAACTTTGCTTTTTCAGG - Intergenic
1109637416 13:65140774-65140796 GGGCATGATGTCATTATATCAGG + Intergenic
1111718023 13:91905098-91905120 AGGCATTGCTTTACTCTATCTGG - Intronic
1112957234 13:105074653-105074675 GGACATTACTTTACAACATCTGG - Intergenic
1116298078 14:43137948-43137970 GCTCATGACTTTGCCATATCTGG + Intergenic
1117051535 14:51865256-51865278 GTGCCTGTCTTTACTAGATCTGG + Intronic
1125042155 15:35201524-35201546 AGGTATGCCTTTAGTATATCAGG - Intergenic
1126370979 15:47946835-47946857 TGGTATGATTTTATTATATCCGG - Intergenic
1128724607 15:69979144-69979166 GGGCATGACTTTGCATTATCTGG + Intergenic
1130161245 15:81402659-81402681 AGTCATGACTTTCCTATAACTGG - Intergenic
1130730568 15:86487898-86487920 GGGCATGCCTGTTTTATATCGGG + Intronic
1136614909 16:31392885-31392907 TGGCATGACTTTATTATTTTGGG + Intergenic
1136708875 16:32216704-32216726 AGGCATTGCTTTACTCTATCTGG + Intergenic
1136759033 16:32712720-32712742 AGGCATTGCTTTACTCTATCTGG - Intergenic
1136809074 16:33157664-33157686 AGGCATTGCTTTACTCTATCTGG + Intergenic
1136815550 16:33267744-33267766 AGGCATTGCTTTACTCTATCTGG + Intronic
1139524702 16:67507694-67507716 GGGCCTGACTCTTCTATATAAGG - Intergenic
1203061191 16_KI270728v1_random:973045-973067 AGGCATTGCTTTACTCTATCTGG - Intergenic
1152511449 17:80792304-80792326 GGGCCTGAATTTACTAAATTAGG + Intronic
1158728226 18:59994346-59994368 GGACATGACTTTTCTTTATATGG + Intergenic
1159942031 18:74415524-74415546 GGGCTTGACTTTCCTATTTAGGG - Intergenic
926788631 2:16546710-16546732 GGGTTTGATTTTAGTATATCAGG + Intergenic
927522947 2:23711996-23712018 GGGCATGGCCTAACTATAACCGG - Intergenic
928743367 2:34382573-34382595 TAGCATGATTTTACTATATTAGG + Intergenic
931575962 2:63719167-63719189 TGGCATGACATTACTCTCTCAGG + Intronic
940683326 2:156814078-156814100 GGGCAAGACTCTACAATATGAGG + Intergenic
942143399 2:173001133-173001155 GGGCATGAGTTTACTTTACATGG - Intronic
1176686197 21:9850470-9850492 GGACATTACTTTATTATTTCAGG - Intergenic
1177766048 21:25458697-25458719 TGGCATGACTTTTCCATGTCAGG - Intergenic
1182379110 22:29872156-29872178 GGGCAAGACTTTCCTGTTTCTGG + Intergenic
951838181 3:27004721-27004743 GGGCAAGACTTTTCTTTATATGG + Intergenic
973343735 4:49031928-49031950 GGGCATGACTTGACTGTCTTGGG - Intronic
990660197 5:58005226-58005248 TGGCATGACTTTATTATAGAAGG + Intergenic
991260703 5:64664572-64664594 GAGCATGACTTTTTTATATTGGG + Intergenic
992278195 5:75143293-75143315 AGGCATGCTTTTACTATATAAGG + Intronic
992890279 5:81197616-81197638 GAGCAAGATTTTACTATATTTGG - Intronic
998543641 5:143006852-143006874 GGACATGATTTTTCTAGATCAGG - Intronic
1000517642 5:162259151-162259173 GGTCATGATTCTCCTATATCAGG + Intergenic
1001887654 5:175309959-175309981 GTGCATGATCTTCCTATATCTGG + Intergenic
1004190063 6:13455974-13455996 GGGCATGATTTTGCTACAGCAGG + Intronic
1005753812 6:28907772-28907794 AGGCATGACTTTCCTTGATCTGG - Intronic
1007430847 6:41775992-41776014 GGGCTTGACTTTCCTAGGTCAGG - Intronic
1009937754 6:70253614-70253636 GGGCATGACTTTACTATATCTGG + Intronic
1013569335 6:111405503-111405525 TGGCATGAATTTAATAAATCTGG - Exonic
1018568413 6:165182399-165182421 TGACATGACTTTACTCTCTCTGG - Intergenic
1023365080 7:39456053-39456075 GGCCCTGTCTTTAATATATCAGG + Intronic
1042549057 8:69977011-69977033 GTGGATGACTATACTATATCTGG + Intergenic
1042676479 8:71327545-71327567 GGGCCTCACTTTACGATATTTGG + Intronic
1048957753 8:139550790-139550812 GGCCATTACTTTACTTTGTCAGG - Intergenic
1057332887 9:94132226-94132248 GTGCATGACTGTACTATGGCAGG + Intergenic
1187215907 X:17276083-17276105 GACCATGACTATATTATATCTGG - Intergenic
1189648006 X:43155176-43155198 GGGCATGAATTAATTATTTCTGG + Intergenic
1196576797 X:117327744-117327766 TGGCATGACTTCACTCTATTTGG - Intergenic