ID: 1009943153

View in Genome Browser
Species Human (GRCh38)
Location 6:70312975-70312997
Sequence AATTAGATGCAGAGTGAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009943153_1009943155 18 Left 1009943153 6:70312975-70312997 CCCGCTTCACTCTGCATCTAATT No data
Right 1009943155 6:70313016-70313038 TTCTTCATAAACTCTCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009943153 Original CRISPR AATTAGATGCAGAGTGAAGC GGG (reversed) Intergenic
No off target data available for this crispr