ID: 1009945326

View in Genome Browser
Species Human (GRCh38)
Location 6:70336271-70336293
Sequence TCATCTATAAGCCCCTGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009945316_1009945326 16 Left 1009945316 6:70336232-70336254 CCCTTCTCCCAGGTGCTGTGTCC No data
Right 1009945326 6:70336271-70336293 TCATCTATAAGCCCCTGACTGGG No data
1009945312_1009945326 26 Left 1009945312 6:70336222-70336244 CCACAGCCGCCCCTTCTCCCAGG No data
Right 1009945326 6:70336271-70336293 TCATCTATAAGCCCCTGACTGGG No data
1009945323_1009945326 -5 Left 1009945323 6:70336253-70336275 CCCAGGAATTTGGGAGCTTCATC No data
Right 1009945326 6:70336271-70336293 TCATCTATAAGCCCCTGACTGGG No data
1009945320_1009945326 8 Left 1009945320 6:70336240-70336262 CCAGGTGCTGTGTCCCAGGAATT No data
Right 1009945326 6:70336271-70336293 TCATCTATAAGCCCCTGACTGGG No data
1009945315_1009945326 17 Left 1009945315 6:70336231-70336253 CCCCTTCTCCCAGGTGCTGTGTC No data
Right 1009945326 6:70336271-70336293 TCATCTATAAGCCCCTGACTGGG No data
1009945311_1009945326 27 Left 1009945311 6:70336221-70336243 CCCACAGCCGCCCCTTCTCCCAG No data
Right 1009945326 6:70336271-70336293 TCATCTATAAGCCCCTGACTGGG No data
1009945314_1009945326 20 Left 1009945314 6:70336228-70336250 CCGCCCCTTCTCCCAGGTGCTGT No data
Right 1009945326 6:70336271-70336293 TCATCTATAAGCCCCTGACTGGG No data
1009945319_1009945326 9 Left 1009945319 6:70336239-70336261 CCCAGGTGCTGTGTCCCAGGAAT No data
Right 1009945326 6:70336271-70336293 TCATCTATAAGCCCCTGACTGGG No data
1009945324_1009945326 -6 Left 1009945324 6:70336254-70336276 CCAGGAATTTGGGAGCTTCATCT No data
Right 1009945326 6:70336271-70336293 TCATCTATAAGCCCCTGACTGGG No data
1009945317_1009945326 15 Left 1009945317 6:70336233-70336255 CCTTCTCCCAGGTGCTGTGTCCC No data
Right 1009945326 6:70336271-70336293 TCATCTATAAGCCCCTGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009945326 Original CRISPR TCATCTATAAGCCCCTGACT GGG Intergenic