ID: 1009945869

View in Genome Browser
Species Human (GRCh38)
Location 6:70341330-70341352
Sequence CACAGGGATGGAGCTACCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009945869_1009945876 17 Left 1009945869 6:70341330-70341352 CCTTGGGTAGCTCCATCCCTGTG No data
Right 1009945876 6:70341370-70341392 CTGCCTCCTGGCTGCTTTCATGG No data
1009945869_1009945879 22 Left 1009945869 6:70341330-70341352 CCTTGGGTAGCTCCATCCCTGTG No data
Right 1009945879 6:70341375-70341397 TCCTGGCTGCTTTCATGGGCTGG 0: 350
1: 579
2: 976
3: 1101
4: 1218
1009945869_1009945877 18 Left 1009945869 6:70341330-70341352 CCTTGGGTAGCTCCATCCCTGTG No data
Right 1009945877 6:70341371-70341393 TGCCTCCTGGCTGCTTTCATGGG No data
1009945869_1009945874 5 Left 1009945869 6:70341330-70341352 CCTTGGGTAGCTCCATCCCTGTG No data
Right 1009945874 6:70341358-70341380 GCAGAGCACAGCCTGCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009945869 Original CRISPR CACAGGGATGGAGCTACCCA AGG (reversed) Intergenic
No off target data available for this crispr