ID: 1009945874

View in Genome Browser
Species Human (GRCh38)
Location 6:70341358-70341380
Sequence GCAGAGCACAGCCTGCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009945869_1009945874 5 Left 1009945869 6:70341330-70341352 CCTTGGGTAGCTCCATCCCTGTG No data
Right 1009945874 6:70341358-70341380 GCAGAGCACAGCCTGCCTCCTGG No data
1009945868_1009945874 10 Left 1009945868 6:70341325-70341347 CCATGCCTTGGGTAGCTCCATCC No data
Right 1009945874 6:70341358-70341380 GCAGAGCACAGCCTGCCTCCTGG No data
1009945871_1009945874 -7 Left 1009945871 6:70341342-70341364 CCATCCCTGTGGCTTTGCAGAGC No data
Right 1009945874 6:70341358-70341380 GCAGAGCACAGCCTGCCTCCTGG No data
1009945867_1009945874 11 Left 1009945867 6:70341324-70341346 CCCATGCCTTGGGTAGCTCCATC No data
Right 1009945874 6:70341358-70341380 GCAGAGCACAGCCTGCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009945874 Original CRISPR GCAGAGCACAGCCTGCCTCC TGG Intergenic
No off target data available for this crispr