ID: 1009945877

View in Genome Browser
Species Human (GRCh38)
Location 6:70341371-70341393
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009945868_1009945877 23 Left 1009945868 6:70341325-70341347 CCATGCCTTGGGTAGCTCCATCC No data
Right 1009945877 6:70341371-70341393 TGCCTCCTGGCTGCTTTCATGGG No data
1009945873_1009945877 1 Left 1009945873 6:70341347-70341369 CCTGTGGCTTTGCAGAGCACAGC No data
Right 1009945877 6:70341371-70341393 TGCCTCCTGGCTGCTTTCATGGG No data
1009945872_1009945877 2 Left 1009945872 6:70341346-70341368 CCCTGTGGCTTTGCAGAGCACAG No data
Right 1009945877 6:70341371-70341393 TGCCTCCTGGCTGCTTTCATGGG No data
1009945871_1009945877 6 Left 1009945871 6:70341342-70341364 CCATCCCTGTGGCTTTGCAGAGC No data
Right 1009945877 6:70341371-70341393 TGCCTCCTGGCTGCTTTCATGGG No data
1009945869_1009945877 18 Left 1009945869 6:70341330-70341352 CCTTGGGTAGCTCCATCCCTGTG No data
Right 1009945877 6:70341371-70341393 TGCCTCCTGGCTGCTTTCATGGG No data
1009945867_1009945877 24 Left 1009945867 6:70341324-70341346 CCCATGCCTTGGGTAGCTCCATC No data
Right 1009945877 6:70341371-70341393 TGCCTCCTGGCTGCTTTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009945877 Original CRISPR TGCCTCCTGGCTGCTTTCAT GGG Intergenic
No off target data available for this crispr