ID: 1009945879

View in Genome Browser
Species Human (GRCh38)
Location 6:70341375-70341397
Sequence TCCTGGCTGCTTTCATGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4224
Summary {0: 350, 1: 579, 2: 976, 3: 1101, 4: 1218}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009945871_1009945879 10 Left 1009945871 6:70341342-70341364 CCATCCCTGTGGCTTTGCAGAGC No data
Right 1009945879 6:70341375-70341397 TCCTGGCTGCTTTCATGGGCTGG 0: 350
1: 579
2: 976
3: 1101
4: 1218
1009945867_1009945879 28 Left 1009945867 6:70341324-70341346 CCCATGCCTTGGGTAGCTCCATC No data
Right 1009945879 6:70341375-70341397 TCCTGGCTGCTTTCATGGGCTGG 0: 350
1: 579
2: 976
3: 1101
4: 1218
1009945873_1009945879 5 Left 1009945873 6:70341347-70341369 CCTGTGGCTTTGCAGAGCACAGC No data
Right 1009945879 6:70341375-70341397 TCCTGGCTGCTTTCATGGGCTGG 0: 350
1: 579
2: 976
3: 1101
4: 1218
1009945869_1009945879 22 Left 1009945869 6:70341330-70341352 CCTTGGGTAGCTCCATCCCTGTG No data
Right 1009945879 6:70341375-70341397 TCCTGGCTGCTTTCATGGGCTGG 0: 350
1: 579
2: 976
3: 1101
4: 1218
1009945868_1009945879 27 Left 1009945868 6:70341325-70341347 CCATGCCTTGGGTAGCTCCATCC No data
Right 1009945879 6:70341375-70341397 TCCTGGCTGCTTTCATGGGCTGG 0: 350
1: 579
2: 976
3: 1101
4: 1218
1009945872_1009945879 6 Left 1009945872 6:70341346-70341368 CCCTGTGGCTTTGCAGAGCACAG No data
Right 1009945879 6:70341375-70341397 TCCTGGCTGCTTTCATGGGCTGG 0: 350
1: 579
2: 976
3: 1101
4: 1218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009945879 Original CRISPR TCCTGGCTGCTTTCATGGGC TGG Intergenic
Too many off-targets to display for this crispr