ID: 1009952498

View in Genome Browser
Species Human (GRCh38)
Location 6:70413478-70413500
Sequence CGCAGTCGCCCCAGTCCCGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 44}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009952498_1009952502 -1 Left 1009952498 6:70413478-70413500 CCCTCGGGACTGGGGCGACTGCG 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1009952502 6:70413500-70413522 GCATGCTCGCTGGCCGCGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 44
1009952498_1009952506 28 Left 1009952498 6:70413478-70413500 CCCTCGGGACTGGGGCGACTGCG 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1009952506 6:70413529-70413551 GCCGAGCCGCGGTGACGAACCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1009952498_1009952501 -2 Left 1009952498 6:70413478-70413500 CCCTCGGGACTGGGGCGACTGCG 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1009952501 6:70413499-70413521 CGCATGCTCGCTGGCCGCGCTGG 0: 1
1: 0
2: 2
3: 5
4: 55
1009952498_1009952504 17 Left 1009952498 6:70413478-70413500 CCCTCGGGACTGGGGCGACTGCG 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1009952504 6:70413518-70413540 CTGGGCCAGTAGCCGAGCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009952498 Original CRISPR CGCAGTCGCCCCAGTCCCGA GGG (reversed) Exonic
911306184 1:96235175-96235197 CACAGATGCCCCAGTCCAGAGGG + Intergenic
912798450 1:112706731-112706753 CTCAGACGCCCCAGCCCCCAGGG - Intronic
1071575633 10:86723946-86723968 AGGAGTAGCCCCAGTCCTGATGG - Intronic
1073503882 10:103967205-103967227 CGGCGGCGCCCCAGACCCGAGGG + Exonic
1079128942 11:17736416-17736438 CGCCGTCGCCCGAGTCGCCAGGG - Exonic
1083990509 11:66243398-66243420 CTCACTCGCCCAGGTCCCGAAGG + Exonic
1085772369 11:79336985-79337007 CACAGTCTCCCCAGGCCCCAGGG + Intronic
1094577379 12:31699545-31699567 CGCAGGAGCCCCTGTCCCCATGG - Intronic
1101680269 12:106956768-106956790 AGCACTCCCCCCACTCCCGAAGG - Intronic
1101716962 12:107319897-107319919 CGCGGCCGCCGCAGTCCCGCCGG + Exonic
1104724066 12:131065476-131065498 CGGAGTCACCCCTGTCCCGTGGG + Intronic
1113505156 13:110811693-110811715 CGCAGTGGCCCTGGTCCCCAGGG + Intergenic
1121369862 14:93347153-93347175 CGCAGGCGCCCCAGCCACGAGGG - Intronic
1128285477 15:66433215-66433237 TGCAGTGTCCCCAGTCCCTAAGG - Intronic
1128639739 15:69327523-69327545 CTCAGTCTCCCCAGTGCCTAGGG + Intronic
1128789677 15:70423811-70423833 TGCAGGCTCCCCAGTTCCGAGGG + Intergenic
1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG + Exonic
1162951097 19:14072639-14072661 CCGAGGCGCCCCTGTCCCGAGGG + Intronic
1163111173 19:15161515-15161537 CGCAGCCCCCCCGGTCCCCACGG - Exonic
1163431214 19:17268882-17268904 CGCACTCGCTCCAATCCTGAAGG + Exonic
1163826874 19:19528941-19528963 CGCAGCCGGCCCAGACCCGTCGG + Exonic
1165192219 19:34074567-34074589 CTCTGTCGCCCCAGTCTGGAGGG + Intergenic
1167866982 19:52336651-52336673 CGCCGCAGCCCCAGTCCCGGCGG + Intronic
949026460 2:241768513-241768535 CACAGTCACCCCCCTCCCGAGGG - Exonic
1171959841 20:31485692-31485714 CCCAGACGCCCCAGCCCCGGGGG + Intergenic
1175869749 20:62203103-62203125 TGGAGTCGCCCCAGGCCTGACGG + Intronic
1177882968 21:26716099-26716121 TGCAGACGCCCCAGTCTCCAAGG + Intergenic
1181047975 22:20224548-20224570 CTCAGTCCACCCAGTGCCGATGG - Intergenic
1184465840 22:44668634-44668656 CGCAGCCGCCGCAGCCCCCAGGG - Intronic
1184788271 22:46682516-46682538 CGCCCTCGTCGCAGTCCCGAGGG - Intergenic
950365950 3:12484381-12484403 CGCACTCCGCCAAGTCCCGACGG + Intergenic
961751124 3:129095457-129095479 AGCAGTGGGCCCAGTCCTGAGGG - Intronic
982157232 4:152535291-152535313 CTCCCCCGCCCCAGTCCCGAGGG - Exonic
984873257 4:184345803-184345825 CACAGTCACCCCAGGCCCCAAGG - Intergenic
996116704 5:119628247-119628269 GGCAGTGGCCCCAGTCCAGTGGG - Intronic
997568200 5:134905301-134905323 CGGGTTCGCCCCAGTCCCGCTGG - Intronic
1000388870 5:160701921-160701943 AGCAGTCACCCCTCTCCCGAGGG + Intronic
1001030590 5:168259699-168259721 TGCAGTGGCCCCAGTCCAAAAGG + Intronic
1009952498 6:70413478-70413500 CGCAGTCGCCCCAGTCCCGAGGG - Exonic
1023773693 7:43583344-43583366 CGCCGCCGCCCCAGGCCCGCGGG + Exonic
1034447068 7:151119190-151119212 TGCAGTGGTCCCTGTCCCGAGGG + Intronic
1035819073 8:2572053-2572075 CCCAGTCTCCCCAGTCTCCATGG - Intergenic
1047382127 8:124373047-124373069 CGCTGCCACCCCAGCCCCGACGG + Intergenic
1049370521 8:142262101-142262123 CGGAGTCGCCGCAGGCCTGAAGG - Intronic
1062581823 9:137232208-137232230 CTCTGTCTCCCCAGTCCCGTTGG - Intronic
1186862720 X:13689308-13689330 CGCACTCCGCCCGGTCCCGAAGG - Intronic