ID: 1009952782

View in Genome Browser
Species Human (GRCh38)
Location 6:70415355-70415377
Sequence TTCCTTATGTTGTCTGTGTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 527
Summary {0: 1, 1: 0, 2: 0, 3: 57, 4: 469}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009952781_1009952782 -9 Left 1009952781 6:70415341-70415363 CCACAAACAAATTCTTCCTTATG 0: 1
1: 0
2: 4
3: 45
4: 476
Right 1009952782 6:70415355-70415377 TTCCTTATGTTGTCTGTGTCAGG 0: 1
1: 0
2: 0
3: 57
4: 469

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009952782 Original CRISPR TTCCTTATGTTGTCTGTGTC AGG Exonic
900084195 1:880610-880632 TTTCTTATGGTGCCTTTGTCTGG + Intergenic
900225605 1:1532251-1532273 TTTCTTGTGGTGTCTTTGTCTGG + Intronic
900667192 1:3823431-3823453 ATCCTTGTGTTTTATGTGTCTGG + Exonic
900963797 1:5943591-5943613 TTCCTCATGTTGCCTTTGACTGG - Intronic
901903266 1:12385684-12385706 TTCCTTCTGTTTTCTCTGTTTGG + Intronic
902850139 1:19148903-19148925 TTCCTTCTGCTGCCTGTGGCAGG + Intronic
903611349 1:24616291-24616313 TTTCTTATGATGTCTTTGTTTGG + Intergenic
903759616 1:25688893-25688915 TCCCTTGGGTTGTCTGTCTCAGG + Intronic
906349034 1:45041126-45041148 TTGCTTATGTTTCCTTTGTCAGG - Intronic
906959412 1:50407793-50407815 TTTCTTGTGATGTCTTTGTCTGG - Intergenic
907017227 1:51028686-51028708 TTCCTTGTGATGTCTTTTTCTGG - Intergenic
907699305 1:56767676-56767698 TTCTTTTTTTTTTCTGTGTCTGG - Intronic
908047770 1:60190070-60190092 TTCCTTGTGCTGTCTTTGTCTGG - Intergenic
908682354 1:66676254-66676276 TTCATTATGTTGTCTAGGACAGG - Intronic
909108683 1:71446952-71446974 TTCATGATGTTGTCTGTAACTGG + Intronic
909118238 1:71567184-71567206 TTCTTTTTGTTGTGTGTGTGTGG + Intronic
909766563 1:79363469-79363491 TTCTTTATGTTTTCTTTGTTTGG - Intergenic
910201857 1:84708259-84708281 TTCCTTCTGTTGTAGGTGTCAGG + Intergenic
910372736 1:86534559-86534581 TTTCTTATAATGTCTTTGTCTGG + Intergenic
910984102 1:92988448-92988470 TTTCTTATAATGTCTTTGTCTGG + Intergenic
911133576 1:94416475-94416497 ATCCTTGTGTTATCTGTGCCAGG + Intergenic
912664290 1:111565110-111565132 TGCATTATGTTCTCTGTGCCTGG - Intronic
912910376 1:113753214-113753236 GTTCTTATGATGTCTTTGTCTGG + Intronic
913028214 1:114868532-114868554 TTTCTTATAATGTCTTTGTCTGG + Intronic
913031233 1:114905145-114905167 TTTCTTTTGCTATCTGTGTCTGG + Intronic
913839369 1:123393525-123393547 TTCCTTGTGTTGTGTGTATTCGG + Intergenic
915224533 1:154402868-154402890 TTCCTTCTGTTGTCTGGGTGAGG + Intergenic
915747078 1:158170466-158170488 TGCTTTATGTTGTCTTTTTCAGG + Intergenic
916042458 1:160973088-160973110 TTCCCTCTGTTCTCTGTGACAGG + Intergenic
916396639 1:164396834-164396856 TTGCTTATGATGTCTTTGTCTGG - Intergenic
916418211 1:164611987-164612009 TACATCATGTTGCCTGTGTCAGG - Intronic
916453528 1:164945902-164945924 TTTCTTATGATGTATTTGTCTGG + Intergenic
916809361 1:168291988-168292010 TTCCTCTTGTTTTCTGTGTTAGG + Intronic
917809230 1:178641626-178641648 TTCCTTTTGTGGTCCGTGTAGGG + Intergenic
918305968 1:183246381-183246403 TTCCTTATCTTGGCAGCGTCAGG - Intergenic
919261564 1:195201979-195202001 TTCCTTAGGTTGTATTTTTCAGG + Intergenic
921005316 1:211087230-211087252 TTCCTTTTGTCGTCTGTATTTGG + Intronic
921872019 1:220151659-220151681 TTCCTTCTTTTGTCTGGGTGTGG + Exonic
922507503 1:226135089-226135111 TTCCTTATTTGGTCTGCCTCTGG + Intergenic
923379809 1:233405406-233405428 TTGCTTTTCTTGTCTTTGTCTGG - Intergenic
923703703 1:236325506-236325528 TTTCTTGTATTGTCTTTGTCTGG - Intergenic
923781891 1:237032163-237032185 TTCCGTCTGCAGTCTGTGTCTGG + Intergenic
924244351 1:242067976-242067998 TTTCTTATGGTGTCTTCGTCTGG + Intergenic
924490990 1:244537436-244537458 TTTCTTGTGATGTCTTTGTCTGG + Intronic
1063899099 10:10713379-10713401 TTACTGAAGTTCTCTGTGTCAGG - Intergenic
1064194778 10:13235767-13235789 TTCCTAATGTTGCCTTTGTTAGG + Intergenic
1064705225 10:18065488-18065510 TTTCTTATAATGTCTTTGTCTGG + Intergenic
1064727125 10:18291588-18291610 TTACTTATGATATCTGTGTCTGG + Intronic
1064801448 10:19078485-19078507 TTTCTTGTGATGTCTTTGTCTGG + Intronic
1065051054 10:21792391-21792413 TTCCTTGTGATGTCTTTGTCTGG - Intronic
1065198591 10:23291550-23291572 TTCATTATGGAGGCTGTGTCCGG + Intronic
1065605102 10:27410335-27410357 TTTCTTATGATGTCATTGTCTGG - Intronic
1065710998 10:28517827-28517849 TTTCTTGTGATGTCTTTGTCTGG + Intergenic
1066195040 10:33090839-33090861 TTCCTTAGGTTTTCTGTGGAAGG + Intergenic
1066301100 10:34097065-34097087 TTCCTTATGGATTCTCTGTCTGG - Intergenic
1066511417 10:36101845-36101867 TTTCTTATAATGTCTTTGTCTGG - Intergenic
1066658379 10:37715957-37715979 TTTCATGTGTTGTCTTTGTCTGG + Intergenic
1067229784 10:44398040-44398062 TTGCCTGTGCTGTCTGTGTCTGG - Intergenic
1069684128 10:70306472-70306494 TTCCTCATTTTGTGTTTGTCTGG + Intronic
1070078464 10:73161715-73161737 TTTCTCATATTGTCTTTGTCTGG - Intronic
1070463615 10:76694871-76694893 TTTCTTATAATGTCTGTGTCGGG - Intergenic
1070484470 10:76916212-76916234 TACCTTATGTGGTCTGTGTTTGG - Intronic
1070936641 10:80303632-80303654 TTTCTTGTGATGTCTTTGTCTGG - Intergenic
1071891814 10:90016461-90016483 TTTCTTGTGGTGTCTTTGTCTGG + Intergenic
1072518702 10:96211437-96211459 TTCTTTTTCTTGTCTGTGTTTGG - Intronic
1072698216 10:97620180-97620202 TTCCCTATGTTTTCTGATTCTGG - Intronic
1073383202 10:103097648-103097670 TTCCTCATGATGTCTGCCTCAGG + Intronic
1073485555 10:103816154-103816176 TTCTTTATTTTGTGTGTGTGTGG - Intronic
1074279914 10:112041231-112041253 TTCCTTTTTTTGTGTGTTTCTGG - Intergenic
1074459576 10:113624991-113625013 TCCCTCATGGTGTCTCTGTCTGG + Intronic
1075444711 10:122505386-122505408 TTCCTTATTTGGTGTGTGTTGGG + Intronic
1076153372 10:128182971-128182993 TTGCTTGTATTGTCTTTGTCTGG + Intergenic
1077449577 11:2630374-2630396 TTTCTTATATTGTCCTTGTCTGG + Intronic
1077581089 11:3417829-3417851 TTCCTGCTCTTGTCTGTCTCTGG - Intergenic
1078048193 11:7937487-7937509 TTCCTTTTGTAGTCTGTGACAGG - Intergenic
1078664361 11:13312331-13312353 TACTTTATCTTGCCTGTGTCTGG + Intronic
1080152412 11:29068720-29068742 TTCCTCATGATGTCTTTGCCTGG - Intergenic
1081053178 11:38372530-38372552 TTGCTTTTGTTGCCTGTGTTTGG - Intergenic
1081063800 11:38513837-38513859 TTTCTTACGGTGTCTTTGTCTGG + Intergenic
1081087147 11:38815121-38815143 CTCCTTATGTTGTCTATGCATGG - Intergenic
1081105956 11:39069563-39069585 TTTCTTGTGATGTCTTTGTCTGG + Intergenic
1081117868 11:39227314-39227336 TCCCTTATGTTGCCAGTGACTGG - Intergenic
1081725704 11:45327161-45327183 TTTCTTGTGATGTCTGTGCCTGG - Intergenic
1083716106 11:64577963-64577985 TGCTTTATGATGTCTGTGCCTGG - Intergenic
1083824971 11:65195702-65195724 TTCCTTGTGGTGTCTTTATCTGG + Intronic
1084479160 11:69408513-69408535 TTTCTTATGATGTCCTTGTCCGG + Intergenic
1084695713 11:70754293-70754315 TGTCTTATGCTGTCTTTGTCTGG - Intronic
1085194966 11:74664571-74664593 TTTCTTATGATGTCTTTGTCTGG - Intronic
1085943352 11:81234411-81234433 TTCATTTTGGTGTCTGTCTCTGG + Intergenic
1086328593 11:85730271-85730293 TTTCTTGTGTTGTCTCTGCCAGG - Intronic
1086541657 11:87919565-87919587 TTCCTTGTGGTGTCCTTGTCTGG + Intergenic
1086880207 11:92144974-92144996 TTCCTTAGCTTTTGTGTGTCTGG + Intergenic
1087459647 11:98429543-98429565 TTTCTTATAGTGTCTTTGTCTGG + Intergenic
1087548075 11:99609923-99609945 TTCCTCATGTTCTATGTGCCAGG + Intronic
1089506705 11:118968058-118968080 TTGCTTTTGGTGTCTTTGTCAGG - Intergenic
1089591217 11:119541898-119541920 TTCCTTTTCTTCTCTGTGCCAGG - Intergenic
1090108669 11:123880414-123880436 TTGCTTATAATGTCTTTGTCTGG - Intergenic
1090164394 11:124532028-124532050 TTTCTTATAGTGTCTTTGTCTGG - Intergenic
1090284011 11:125483209-125483231 TTCCTGATTTTGTTTGTATCAGG + Intronic
1090304442 11:125678618-125678640 TTCCTGATGCTGACTTTGTCAGG - Intronic
1090739814 11:129648402-129648424 TTTCTTATAATGTCTTTGTCTGG - Intergenic
1092176696 12:6413336-6413358 TTCCTTGTAATGTCTTTGTCTGG + Intergenic
1093009644 12:14092830-14092852 TTTCTTGTGCTGTCTTTGTCTGG - Intergenic
1093613506 12:21192074-21192096 TTCCTTTTGGTGTCTTTGTCTGG + Intronic
1093807020 12:23446821-23446843 GTCCTTATGTATTCTGTGTGAGG - Intergenic
1094673351 12:32593427-32593449 ATCCTTGTGTTGGCTTTGTCAGG + Intronic
1094812914 12:34158837-34158859 TTTCTTATGCTGTCTTTGTCTGG - Intergenic
1095341546 12:41095184-41095206 TTCCTTATGTTGAGTGTTTAGGG - Intergenic
1095479186 12:42617002-42617024 TCCCTTATGGTGTTTTTGTCAGG - Intergenic
1095823129 12:46502017-46502039 TTTCTTGTGTTGTCTTTGTCTGG + Intergenic
1096321509 12:50617925-50617947 TTGCTTATGTTGTTTGTTTATGG + Intronic
1099808535 12:87550725-87550747 CTTCTTATGTTGTATATGTCTGG - Intergenic
1101406000 12:104429324-104429346 TGCCTTATGGTTTATGTGTCTGG + Intergenic
1101459468 12:104875445-104875467 TTTCTTGTGGTGTCTTTGTCTGG + Intronic
1101988653 12:109467002-109467024 TTCCAGCTGTTGTCTGTGTCTGG - Intronic
1103961182 12:124610101-124610123 GACCTTATGTTGTCAGGGTCTGG - Intergenic
1105703612 13:22953228-22953250 TTCCTTATGATATCTTTGTCAGG - Intergenic
1105713934 13:23042461-23042483 TTTCTTATAGTGTCTTTGTCTGG + Intergenic
1105856570 13:24378290-24378312 TTTCTTATGATATCTTTGTCAGG - Intergenic
1106170991 13:27288412-27288434 TTCTTTCTGGTTTCTGTGTCAGG + Intergenic
1106959494 13:34981641-34981663 TTCCTTATAATGTCCTTGTCAGG + Intronic
1107230775 13:38107463-38107485 TTCTTTATTCTGTCTGTGCCAGG - Intergenic
1107705531 13:43099893-43099915 TTTCTTATGATATCTTTGTCTGG + Intronic
1107866170 13:44705348-44705370 TTCCTTATGTCTTGTGTGTTTGG - Intergenic
1108158613 13:47614708-47614730 TTCCTTTTTTTGTCTCTGCCAGG + Intergenic
1109574495 13:64235846-64235868 TTTCTTGTGATGTCTTTGTCTGG - Intergenic
1109841155 13:67918313-67918335 TTCCTTATTTTCTCTTTTTCTGG + Intergenic
1110400541 13:75085473-75085495 TTCCTTGTGATATCTGTGTCTGG - Intergenic
1110911292 13:80968017-80968039 TTCTTTATGTTTTCTTTGCCAGG - Intergenic
1111166701 13:84466904-84466926 TTTCTTATATTGTCCTTGTCTGG - Intergenic
1111327492 13:86718605-86718627 TTCCTTGTAGTGTCTTTGTCTGG - Intergenic
1111561146 13:89949068-89949090 TTTCTTGTGATGTCTTTGTCTGG + Intergenic
1111694958 13:91611915-91611937 TTCCTTGTGTTGTCTGCAGCTGG + Intronic
1111783654 13:92760144-92760166 TTTCTTATGGTGTCTTTGTCTGG + Intronic
1111885829 13:94019025-94019047 TTCCTTATTATGTCTTTGTCTGG + Intronic
1113570106 13:111347490-111347512 TTCCTTATGTTACCAGTCTCAGG + Intergenic
1113882305 13:113634125-113634147 GCCCTTATGCTCTCTGTGTCCGG + Intronic
1113978737 13:114253176-114253198 TTTCTTAACTTGTCTGTGTTTGG + Intronic
1114165518 14:20214467-20214489 TTGCTTTTGTTGTCTGTATTTGG + Intergenic
1115976065 14:38998519-38998541 TTGCTTAAGTTCTCTGGGTCTGG - Intergenic
1116241374 14:42347405-42347427 TTTGTTTTGTTGTCTGTCTCAGG + Intergenic
1116409721 14:44607169-44607191 TTACATATGTACTCTGTGTCTGG + Intergenic
1116723530 14:48531598-48531620 TTTCTTATTTTGTCTCTGTATGG + Intergenic
1117587425 14:57224753-57224775 TTCCTTTTTATGTCTTTGTCTGG - Intronic
1117726603 14:58680925-58680947 TTCATTGTGATGTCTGTTTCAGG - Intergenic
1117890300 14:60414012-60414034 TTTCTTGTATTGTCTTTGTCTGG - Intronic
1117938196 14:60931371-60931393 TCACTTTTGTTGCCTGTGTCAGG + Intronic
1118224020 14:63882343-63882365 TTCCATATGTTGTATTTATCAGG + Intronic
1118863389 14:69683282-69683304 TACCTGATGGTGTCTGTGTCTGG - Intronic
1120506759 14:85362457-85362479 AAACTCATGTTGTCTGTGTCTGG + Intergenic
1120687252 14:87551940-87551962 TCCGTTATGGTGTCTTTGTCTGG - Intergenic
1120772953 14:88401025-88401047 TTTCTTGTGTTGTCTTTGTTTGG - Intronic
1121003748 14:90472893-90472915 TTCCATATGTGGTCTCTGGCAGG - Intergenic
1121034193 14:90686026-90686048 TTTCTTATGATGTCTTTGTCTGG - Intronic
1121883851 14:97524849-97524871 TTCCTTTTTTTGTGTGTGTGTGG + Intergenic
1122150971 14:99726123-99726145 TTCCTTATGTTGTTCCTGTGGGG + Intronic
1122185726 14:99993449-99993471 TTTCTTATTTTGTCTTTGTCTGG + Intronic
1122367975 14:101207222-101207244 TTCCTTGTGTTCTCTTTGTCTGG + Intergenic
1122725108 14:103745427-103745449 TTCCTGATGCTGTGTGTTTCAGG + Intronic
1122845271 14:104492256-104492278 TTCCTTATGATATCTTTGTCAGG - Intronic
1123389243 15:19852977-19852999 TGACTTATGCTGTCTGAGTCAGG + Intergenic
1123969380 15:25491668-25491690 TTTCTTATGCTGTCTTTGTCTGG - Intergenic
1124360537 15:29033651-29033673 TTCCTTCTTTTGTCTGGTTCTGG - Intronic
1124608373 15:31189957-31189979 TTCCTTTTAGTGTCTCTGTCTGG - Intergenic
1124792479 15:32742137-32742159 TTTCTTGTGGTGTCTTTGTCCGG + Exonic
1126552253 15:49945538-49945560 TTTCTTGTGTTGTCTTTGTCTGG - Intronic
1127139336 15:55958452-55958474 TTTCTTGTGATGTCTGTGTCTGG + Intronic
1127193402 15:56557789-56557811 TTCCTTGTGATGTCTTTGACTGG + Intergenic
1129058673 15:72842259-72842281 TTTCTTCTGATGTCTTTGTCTGG + Intergenic
1129554410 15:76490664-76490686 TTGCTTTTGTGGTCTGTGTTTGG + Intronic
1129628025 15:77226308-77226330 ATGTTTATGTTGTCAGTGTCTGG - Intronic
1130623467 15:85488380-85488402 TTTCTTGTGATGTCTTTGTCTGG + Intronic
1131959187 15:97770610-97770632 TTCATTATGTTTTCTGTGCTTGG - Intergenic
1132127653 15:99242520-99242542 TTTCTTGTGATGTCTTTGTCTGG - Intronic
1133878925 16:9762688-9762710 GTTTTTATTTTGTCTGTGTCAGG + Exonic
1133923878 16:10179286-10179308 TTCCTTACGTGTTCTTTGTCTGG - Intronic
1134673933 16:16076114-16076136 TTCCTTCTGCTTTCTGGGTCTGG + Intronic
1135697133 16:24598513-24598535 TTCTTTGTGCTGTCTTTGTCTGG + Intergenic
1137496898 16:48976767-48976789 TTCCTGATGCTTTCTTTGTCTGG + Intergenic
1137528296 16:49257530-49257552 TTCCTTGTGGTGTCTTTGTCTGG - Intergenic
1137651399 16:50123741-50123763 TTCCTTGAGTTATCTGTTTCAGG + Intergenic
1137966292 16:52936722-52936744 TTTCTTGTATTGTCTTTGTCTGG - Intergenic
1138303282 16:55950555-55950577 TTCCTTGTGTGTTCTGTTTCTGG - Intronic
1141164771 16:81653073-81653095 TTCTTTCTGTTTTCTGTTTCAGG + Intronic
1141291665 16:82723426-82723448 TCCCTTAAGTTCTCTGTGACTGG + Intronic
1142717920 17:1757207-1757229 CTCCTTCTGTTTTCTGTATCTGG - Intergenic
1142909651 17:3077584-3077606 TTTCTTGTGGTGTCTTTGTCTGG + Intergenic
1142924845 17:3226219-3226241 TTTCTTGTGGTGTCTTTGTCTGG - Intergenic
1145220521 17:21084813-21084835 TTCCTTCTGTTGTCTGGCACTGG + Intergenic
1147584443 17:41645803-41645825 TTCCTTCTTTTTCCTGTGTCTGG + Intergenic
1147639145 17:41983560-41983582 TACCTTTTGTTTTCTCTGTCTGG + Exonic
1149346948 17:55748489-55748511 TTCCTAATGATGCCTGTGCCTGG - Intergenic
1152966084 18:115400-115422 TGCCTTTTGTGGTCTGTGTTTGG + Intergenic
1153031620 18:718791-718813 TTCCATATGTTTTCTGCCTCAGG - Intergenic
1153897759 18:9582703-9582725 TTTCTTATGGTGCCTTTGTCTGG - Intronic
1154286046 18:13057615-13057637 TTCCTCATGCTTGCTGTGTCGGG + Exonic
1154927886 18:20956655-20956677 TGCCTTTTGTGGTCTGTGTTTGG - Intronic
1155563335 18:27104412-27104434 TTACTTTTGTTTTCTGTGACTGG + Intronic
1155583305 18:27336831-27336853 TTTCTTATAGTGTCTTTGTCTGG + Intergenic
1155594315 18:27467040-27467062 TTCCTGATGTTGTTTGTATGTGG - Intergenic
1156082285 18:33351883-33351905 TTGCTTCTGATGTCTTTGTCTGG + Intronic
1156626287 18:38913568-38913590 TTTGTTTTGTTTTCTGTGTCTGG + Intergenic
1157779997 18:50429867-50429889 TTCCTTATGCTGGCTGGGACTGG - Intergenic
1158956483 18:62545046-62545068 TTCCTTATGTTGGTAATGTCAGG - Intronic
1159249531 18:65856251-65856273 TATCTTATTTTGTTTGTGTCAGG - Intronic
1160459352 18:79026291-79026313 ATCCTTTTTTTGTCTGTGCCTGG - Intergenic
1163185220 19:15633982-15634004 TCCCTTAGGTTTTGTGTGTCTGG + Intronic
1164687985 19:30182770-30182792 TTTCTTGTGGTGTCTTTGTCTGG - Intergenic
1166910592 19:46153131-46153153 TTCCTTGTGATGTCTTTGTCTGG + Intronic
1167912028 19:52711549-52711571 CTCCTCATATTTTCTGTGTCTGG - Intronic
1167919698 19:52772810-52772832 CTCCTTGTATTTTCTGTGTCTGG - Intronic
924972936 2:146713-146735 TTTCTTATGGTGTCCTTGTCTGG + Intergenic
925013924 2:507594-507616 CTCCTTCTGTTCTCTGTTTCTGG - Intergenic
925562777 2:5216043-5216065 TGGCTTATTTTTTCTGTGTCTGG - Intergenic
925612080 2:5709953-5709975 TGCCTTATGGTGTCAGTGTCTGG - Intergenic
925684246 2:6455246-6455268 TTCTTTATTTTGTGTGTGTGAGG - Intergenic
925784249 2:7414233-7414255 TTCTTTGTCTTGTCTTTGTCTGG + Intergenic
925928452 2:8686811-8686833 TTTCTTGTGTTGTCTGTAACTGG + Intergenic
926534277 2:14091540-14091562 TTTCTTATGGTGTCTTTGTATGG + Intergenic
927749493 2:25654489-25654511 TTCGTTACGTGGTCTGTCTCAGG - Intronic
927984349 2:27397370-27397392 TTTCTTGTGATGTCTTTGTCTGG - Intronic
928212251 2:29331971-29331993 TCACTTATGTTTTCTGTGGCAGG - Intronic
928744162 2:34391654-34391676 TTTCTTATGTAGTCTCTTTCTGG + Intergenic
929661718 2:43792805-43792827 TTCCGTTTGTAGTATGTGTCAGG + Intronic
929814018 2:45216796-45216818 TTGCTTTTGTTGTCTGTTTTTGG - Intergenic
930717835 2:54609518-54609540 TTCCTGATGTTCTCTCTGTTGGG + Intronic
931012423 2:57932163-57932185 TTCCTTGTTTTGTCCTTGTCTGG + Intronic
931095442 2:58935035-58935057 TACCTTTTGTTGGCTGTTTCTGG - Intergenic
932929898 2:76022315-76022337 TTCCCTATGTTGCCTGTCGCAGG - Intergenic
933256375 2:80085659-80085681 TTCTGCATGTTGTCTGTCTCTGG + Intronic
933418347 2:82016075-82016097 TTTATTATGTTGTCTTTATCTGG + Intergenic
933468021 2:82680903-82680925 TTTCTTATGATGTCTTTGTCTGG - Intergenic
933681005 2:85100669-85100691 TTTCTTGTGATGTCTTTGTCTGG - Intergenic
935125704 2:100220763-100220785 TTTCTTGTGATGTCTTTGTCTGG + Intergenic
935543809 2:104379164-104379186 TTCCTGCAGTTGTCAGTGTCTGG + Intergenic
935599824 2:104911634-104911656 TTTTTTATTTTCTCTGTGTCAGG - Intergenic
936578169 2:113672495-113672517 TTCCCTATTTTGACTGTGGCAGG + Intergenic
936988644 2:118338012-118338034 TTCCTTGTGATGTCCTTGTCTGG + Intergenic
937165381 2:119809915-119809937 TTCAGTATGCTGTCTGTCTCGGG - Exonic
937243583 2:120477934-120477956 TTCCTTCTAATGTCTGTGTCTGG - Intergenic
938404795 2:131025459-131025481 TTCCTGATGTTGGCTCTGCCAGG + Intronic
938426092 2:131189436-131189458 TTCCTTTTTTTGTCTATCTCTGG + Intronic
938784912 2:134618106-134618128 TTCATTATTTTTTCTGAGTCAGG - Intronic
938839248 2:135142936-135142958 TTTATTATGTTGTCCTTGTCAGG + Intronic
939143382 2:138381767-138381789 TTTCTTGTAGTGTCTGTGTCTGG - Intergenic
939678168 2:145097794-145097816 TCACTTGTGATGTCTGTGTCTGG + Intergenic
942365050 2:175216843-175216865 TTTCTTGTGATGTCTTTGTCTGG - Intergenic
942544071 2:177044413-177044435 TTCATAATTTTGTCTGGGTCTGG - Intergenic
942651258 2:178170569-178170591 TTCCTTGTAGTGTTTGTGTCTGG + Intergenic
943022222 2:182589147-182589169 TTCCTTCTGTTTTCTCTTTCAGG - Intergenic
943380969 2:187147219-187147241 TTTCTCATGGTGTCTTTGTCTGG - Intergenic
943669489 2:190646773-190646795 TTCCCAAGCTTGTCTGTGTCTGG - Intronic
943926334 2:193786442-193786464 TTCCTTGTAATGTCTTTGTCTGG - Intergenic
943949666 2:194116475-194116497 TTCTTTATGTTGTCTGTTTTTGG - Intergenic
944776504 2:202972234-202972256 TTACTTATTTTGTGTGTGCCAGG + Intronic
945327887 2:208504240-208504262 TTTCTTATAATGTCTTTGTCTGG + Intronic
945823299 2:214690313-214690335 TTTCTTGTGATGTCTTTGTCTGG - Intergenic
946008938 2:216549266-216549288 TTCCTGATGTTGGCTGCCTCGGG + Intronic
946648005 2:221860665-221860687 TTCCTTATGAAGTCTTTTTCTGG + Intergenic
946875355 2:224124291-224124313 ATCTTTATGTTGACAGTGTCTGG - Intergenic
1168922168 20:1548572-1548594 TTTCTTGTGATGTCTTTGTCTGG + Intronic
1169973605 20:11298535-11298557 TTTCTTATGCTATCTTTGTCTGG - Intergenic
1169984081 20:11422754-11422776 TTTTTTATTGTGTCTGTGTCAGG + Intergenic
1170183723 20:13563445-13563467 TTTCTTATGGTGTCTTTGTATGG - Intronic
1170575218 20:17657404-17657426 TTCCCTATCTTGCCTCTGTCAGG - Intronic
1170636639 20:18111394-18111416 TTCCTTATAATGTCTTTGTCTGG + Intergenic
1171219925 20:23386471-23386493 TTTCTTGTGGTGTCTTTGTCTGG - Intronic
1171397530 20:24846888-24846910 TTTTTTATGGTGTCTCTGTCAGG + Intergenic
1171440576 20:25158282-25158304 TTTCTTGTGATGTCTGTATCTGG + Intergenic
1171775272 20:29360941-29360963 TTACTTATGGTGCCTTTGTCTGG - Intergenic
1171817286 20:29798571-29798593 TTTCTTATGGTGCCTTTGTCTGG - Intergenic
1171901073 20:30857431-30857453 TTTCTTATGGTGCCTTTGTCTGG + Intergenic
1171906433 20:30903304-30903326 TTCCTTGTTTTCTCTGTCTCTGG + Intergenic
1171964739 20:31521014-31521036 TTACTTCTGCTGTTTGTGTCAGG + Intronic
1172724651 20:37028885-37028907 TTTCTTATGCTTTCTTTGTCTGG - Intronic
1173452134 20:43174167-43174189 TACTTTATGTTCTCTCTGTCTGG - Intronic
1174237854 20:49108815-49108837 TTTCTTTTGTTGCCTGTTTCTGG - Intergenic
1175073310 20:56352901-56352923 TGTCTTATTTTGTCTGTATCTGG - Intergenic
1175170713 20:57079341-57079363 TTCCTTGTAGTGTCTTTGTCTGG + Intergenic
1177291357 21:19117788-19117810 TTTCTTATAATGTCTTTGTCGGG + Intergenic
1179148063 21:38786345-38786367 TTCCTTCTGCAGTCTGTTTCTGG + Intergenic
1179431052 21:41321459-41321481 CTCATTTTGTTTTCTGTGTCTGG + Intronic
1180511906 22:16099878-16099900 TGACTTATGCTGTCTGAGTCAGG + Intergenic
1182691389 22:32166111-32166133 CTGCTTGTGCTGTCTGTGTCTGG + Intergenic
1183561603 22:38578962-38578984 TGCCTCATGGTGTCTGTGTGAGG - Intronic
1183815499 22:40296643-40296665 TTCCTTATGGTGTTTCTCTCTGG + Intronic
1183889147 22:40911324-40911346 TTTCTTATGCTGTCTTTTTCTGG + Intronic
1185115791 22:48936885-48936907 TTCCTTTTGTTGTTTGTATTTGG + Intergenic
1185382422 22:50516110-50516132 TCCCTTTTCTTCTCTGTGTCGGG + Intronic
949662780 3:6300025-6300047 TTCCTGCTGTGGTCTGTCTCTGG - Intergenic
951733853 3:25840950-25840972 TTTCTTGTGGTGTCTTTGTCTGG - Intergenic
954437106 3:50502270-50502292 TTGCTTCTGTTATCTGTCTCCGG - Intronic
954591253 3:51784756-51784778 TTTCTTATAGTGTCTTTGTCTGG + Intergenic
955348419 3:58177704-58177726 TGGCTTCTGTTTTCTGTGTCTGG - Intergenic
955827148 3:62960139-62960161 TTTCTTGTGTAGTCTCTGTCTGG + Intergenic
956959681 3:74384233-74384255 TTCCTTGTATTGTTTGTTTCCGG - Intronic
957954854 3:87173282-87173304 TTCCTTCTGTTGTCTTTCTTTGG + Intergenic
958746558 3:98142570-98142592 TTCTTTATATTGTCTGCCTCAGG + Intergenic
958754240 3:98231199-98231221 TTCTTTATATTTTCTGTATCAGG + Intergenic
958865396 3:99495274-99495296 TTTCTTATAATGTCTTTGTCTGG - Intergenic
960098458 3:113711938-113711960 TTTCTTATAATGTCTTTGTCTGG + Intergenic
960198943 3:114807953-114807975 TTCATTGTGATGTCTTTGTCTGG + Intronic
960895430 3:122499793-122499815 TTTCTTGTGATGTCTTTGTCTGG + Intronic
960929346 3:122829107-122829129 TTTCTTATGTTACCTTTGTCGGG - Intronic
961140947 3:124555528-124555550 CACCTTATGTTGTTTTTGTCAGG + Intronic
961300883 3:125921253-125921275 TTCCTGCTCTTGTCTGTCTCTGG + Intergenic
961387823 3:126533684-126533706 TTTCTTGTGATGTCTTTGTCTGG + Intronic
961887631 3:130106839-130106861 TTCCTGCTCTTGTCTGTCTCTGG - Intronic
962359115 3:134721935-134721957 TTCCTTGTGATATCTTTGTCTGG + Intronic
963232256 3:142920046-142920068 TTTCTTATGATATCTTTGTCTGG + Intergenic
963328095 3:143884278-143884300 TTATTTATATTGTCTGTGTCTGG + Intergenic
964833118 3:160908079-160908101 TTCTTTGTATTGTCTGTGTTTGG + Intronic
965351921 3:167623213-167623235 TTTCTTGTGATGTCTTTGTCTGG - Intronic
965537989 3:169844136-169844158 TTTCTTATAATGTCTTTGTCTGG - Intronic
965731525 3:171777311-171777333 TTCCTACTGCTGTCTGTCTCAGG + Intronic
965884541 3:173428843-173428865 TTCCTTAGCTTTTGTGTGTCTGG + Intronic
965951987 3:174320095-174320117 TTTCTTGTGTTATCTTTGTCAGG - Intergenic
966164135 3:176998076-176998098 TTCCTTATGTTATATAAGTCTGG - Intergenic
967091527 3:186138661-186138683 TTTCTTCTGGTGTCAGTGTCAGG + Intronic
968358467 3:198127798-198127820 TTTCTTATGGTGCCTTTGTCTGG + Intergenic
968535084 4:1120766-1120788 TTTCTTATAATGTCTTTGTCTGG - Intergenic
968564267 4:1302028-1302050 TTTCTTGTGATGTCTTTGTCTGG - Intronic
968590737 4:1458555-1458577 TTCCCTCTGTTCCCTGTGTCTGG + Intergenic
968889146 4:3358786-3358808 TTTCTTGTATTGTCTTTGTCTGG + Intronic
970328873 4:14958223-14958245 TTCCTTTTTTTTTCTCTGTCTGG - Intergenic
972143545 4:35992074-35992096 TTTCTTTTGATGTCTTTGTCTGG - Intronic
973551896 4:52043943-52043965 CTCCTTCTGCTGTCTGTGTTTGG - Intergenic
973633136 4:52838195-52838217 TTCCTTCTGTTGCCTATTTCAGG + Intergenic
973841550 4:54866235-54866257 TTCCCTATGTTTTCTCTGTAAGG - Intergenic
975534436 4:75434575-75434597 TTCTTTGTGCTGTCTTTGTCTGG - Intergenic
976201561 4:82584648-82584670 TTTCTTGTGATGTCTTTGTCTGG + Intergenic
976426784 4:84913242-84913264 TTCATGATGTTGTCTCTGTCAGG - Intronic
977187092 4:93952709-93952731 TTTCTTATGGTGTCTTTGTTGGG - Intergenic
978069622 4:104451336-104451358 ATCCTTGTGTAGTCTGTGTAGGG - Intergenic
978389749 4:108213151-108213173 TTCCTAATGTGGCCTGTTTCTGG - Intergenic
978403443 4:108355195-108355217 TTCCTTATGTTGTCAGTGATGGG + Intergenic
979701857 4:123677528-123677550 TTCCTTATATTCTCTTTGTCAGG - Intergenic
980019889 4:127696159-127696181 TTTCTTATAATGTCTTTGTCTGG + Intronic
980787765 4:137576785-137576807 TTCATTAAGCTGTCAGTGTCAGG - Intergenic
981170478 4:141616932-141616954 TTCGTGATGTTCTCTCTGTCAGG + Intergenic
982029650 4:151287411-151287433 TTCCTTGTGATGCCTTTGTCAGG - Intronic
982512709 4:156303681-156303703 TTCCTGTTGTTTTCTCTGTCTGG + Intergenic
983082026 4:163397985-163398007 TTCTTTATGTTTTCTATCTCTGG - Intergenic
983470295 4:168146745-168146767 TTCCTTCTGTAGTCTGTGGGGGG - Intronic
985440074 4:189976504-189976526 TTTCTTATGGTGCCTTTGTCTGG - Intergenic
985567473 5:626978-627000 TTTCTTATATTGCCTTTGTCTGG + Intronic
985840036 5:2299123-2299145 TTGCTTGGTTTGTCTGTGTCAGG - Intergenic
985857007 5:2436261-2436283 TTCCTTACTTAGTGTGTGTCTGG + Intergenic
987434012 5:17871320-17871342 TTCCTTATAGTGTCTTTGTCTGG - Intergenic
987919551 5:24261548-24261570 TTCATTATATTCTCTGTGTAGGG + Intergenic
988642298 5:33053882-33053904 TTTCTTGTGATCTCTGTGTCTGG - Intergenic
989808345 5:45640395-45640417 TTCCCTATGATATCTATGTCTGG + Intronic
990686236 5:58304280-58304302 TTCCTTATGTTCTCTGTTTAAGG + Intergenic
991372629 5:65935410-65935432 TTCCATATGTTATGTGTGTGAGG + Intronic
991438737 5:66623319-66623341 TTTCTTGTGGTGTCTTTGTCTGG - Intronic
992524205 5:77590828-77590850 TTTCTTGTATTGTCTTTGTCAGG + Intronic
993412239 5:87588934-87588956 TTCTTTATTGTGTCTTTGTCTGG + Intergenic
994138089 5:96310394-96310416 TTTCTTATGATGTCTTTGTCTGG + Intergenic
995149572 5:108826561-108826583 TTTCTTATAGTGTCTTTGTCTGG + Intronic
995213722 5:109570892-109570914 TTCCTCATGTTGTCTGATGCTGG + Intergenic
995290018 5:110441389-110441411 TTGCTAATGTTCTCTGTCTCAGG + Intronic
996068686 5:119109174-119109196 TCCCTGATGTTGTCTGTCTCTGG + Intronic
996582092 5:125042450-125042472 TTCCTTTTGTTATGTGTGTATGG + Intergenic
996895598 5:128478244-128478266 TTCCATAGGTAGTGTGTGTCTGG - Intronic
997620503 5:135288218-135288240 TTTCTTACGGTGTCTTTGTCTGG + Intronic
997878098 5:137566907-137566929 TGCCTTCTGTGGTCTGTGCCAGG + Intronic
998818637 5:146037857-146037879 TTTCTTATGTTGTCTTTTCCTGG - Intronic
998997679 5:147883354-147883376 TTCCTCCTGTTGTCAGTTTCTGG + Intronic
999217347 5:149946367-149946389 TTCCTTATGATGGGAGTGTCTGG - Intergenic
1001310848 5:170609298-170609320 TTTATTGAGTTGTCTGTGTCAGG + Intronic
1002032241 5:176438865-176438887 TTCCTTATTTTCTCTGTGGTTGG + Intergenic
1002361617 5:178676100-178676122 TTTCTTGTGATGTCTTTGTCTGG + Intergenic
1002438426 5:179249873-179249895 TTTCTTATGATGTTTTTGTCTGG - Intronic
1002800548 6:518183-518205 GTCCTTATCTTATCTGTGTATGG + Intronic
1003309775 6:4959766-4959788 TTCCTTGTGATGTCTTTGTCTGG - Intergenic
1003820980 6:9896833-9896855 GTTCTTATGTTCACTGTGTCGGG - Intronic
1004290676 6:14364081-14364103 TTACCTGTGGTGTCTGTGTCGGG + Intergenic
1004574667 6:16883676-16883698 TTCATTGTGATGTCTTTGTCTGG + Intergenic
1004641619 6:17521509-17521531 TTAATTATGTGGTCTCTGTCAGG - Intronic
1004952297 6:20687142-20687164 TTTCTTGTGTTGTCTTTGTGTGG + Intronic
1005196421 6:23290606-23290628 TTTCTTATAATGTCTTTGTCAGG - Intergenic
1005411253 6:25549341-25549363 TTCCTGAGGTTGTTTGTATCAGG + Intronic
1005555452 6:26976581-26976603 TTCTTTTTGTTTTCTTTGTCTGG + Intergenic
1006586078 6:35113967-35113989 TTTCTTGTGGTGTCTTTGTCTGG - Intergenic
1007123672 6:39405651-39405673 TTTCTTGTGATGTCTTTGTCTGG + Intronic
1008146784 6:47901310-47901332 TTCCTTGTGATGTTTTTGTCTGG + Intronic
1009952782 6:70415355-70415377 TTCCTTATGTTGTCTGTGTCAGG + Exonic
1010106527 6:72175756-72175778 TTTCTTTTGTTCTGTGTGTCCGG + Intronic
1010342644 6:74773668-74773690 TTTCTTGTGGTGTCTTTGTCTGG + Intergenic
1010365461 6:75045946-75045968 TTTCTTATGATATCTTTGTCTGG - Intergenic
1010836746 6:80597773-80597795 TTCTTTGTTTTGTCTGTGCCAGG + Intergenic
1010898754 6:81400008-81400030 TCCCATATCTTGTCTTTGTCAGG - Intergenic
1011300815 6:85871487-85871509 TTTCTTATAGTGTCTTTGTCTGG + Intergenic
1011302395 6:85890174-85890196 TTCCCACTGTTGTTTGTGTCAGG + Intergenic
1011756816 6:90508602-90508624 TTCCTTATTTTGTCTGTTTGGGG + Intergenic
1013143783 6:107367009-107367031 TTTCTTATGATGTCTTTGTCTGG - Intronic
1013181873 6:107723840-107723862 TTTCTTATGATGTGTCTGTCTGG - Intronic
1014635049 6:123835025-123835047 TTTCTTGTATTGTCTGTATCTGG + Intronic
1014942469 6:127459031-127459053 TCTCTGCTGTTGTCTGTGTCTGG - Intronic
1016339450 6:143046443-143046465 TTCCTTATAATGTCTTTTTCTGG - Intergenic
1016448718 6:144158891-144158913 TTGCTGAAGTTGTCTGTGCCTGG + Intronic
1017673678 6:156792850-156792872 GTCCTTAGGATGTCTGTGTAGGG + Intronic
1017931073 6:158956309-158956331 TTACTTTTGTTGCCTGTTTCTGG + Intergenic
1018004362 6:159606816-159606838 TTTCTTATAATGTCTTTGTCTGG + Intergenic
1019291622 7:253297-253319 TTCCTTTCGCTGACTGTGTCGGG - Intronic
1020321044 7:6939153-6939175 TTCCTACTCTTGTCTGTCTCTGG - Intergenic
1020359540 7:7313447-7313469 TTTCTTATGATGTCTTTATCTGG - Intergenic
1020516477 7:9127212-9127234 TTGCTTTTGTTTTCTGTGTTTGG - Intergenic
1022721359 7:32943982-32944004 TTTCTTATAATGTCTTTGTCTGG + Intergenic
1022839362 7:34148187-34148209 TTCCTGCTGTTCTATGTGTCTGG + Intronic
1023099253 7:36697494-36697516 TTCCTTGTGATGTCTCTGTCTGG + Intronic
1023243364 7:38174363-38174385 TTTCTTATGGTGTCTTTGTCTGG + Intergenic
1023323642 7:39028275-39028297 TTCTTTATGGTGTCTGTTGCTGG + Intronic
1023538434 7:41238794-41238816 CTCCTTCTGTTTTCTGTGGCAGG - Intergenic
1024110270 7:46137978-46138000 TTTCTTATGATGTCTTTGTTTGG + Intergenic
1024120909 7:46238705-46238727 TTTCTTGTGCTGTCTTTGTCTGG - Intergenic
1024298965 7:47871047-47871069 TTTCCTGTGTTGTCTTTGTCTGG - Intronic
1024597622 7:50953415-50953437 TTATTTATGTTATCTGTGTAAGG - Intergenic
1026446706 7:70490976-70490998 CTCTTGATGTTGTCTGGGTCTGG - Intronic
1027683243 7:81246836-81246858 TTGCTTTTGGTGTCTTTGTCAGG - Intergenic
1028308307 7:89294964-89294986 TTCCTCATGTTCTTTGTGTGAGG + Intronic
1029613929 7:101644645-101644667 TTATTTATGTTGTCTATTTCAGG + Intergenic
1029963717 7:104715855-104715877 TTCCTTGTGGTGTCTTTGCCTGG + Intronic
1030089430 7:105844271-105844293 TTTCTTATGATGTCTTTGTCTGG - Intronic
1030320041 7:108156696-108156718 GTCCTAATTTTGTATGTGTCTGG + Intronic
1030483107 7:110129279-110129301 TGCCTGATGTTGTGTGTTTCTGG + Intergenic
1031590637 7:123587997-123588019 TTTCTTATGGTGTCCTTGTCTGG + Intronic
1032570146 7:132987245-132987267 TTCATGATGTTCTCTCTGTCCGG - Intronic
1033445365 7:141416820-141416842 CTCGTTATGTACTCTGTGTCTGG - Intronic
1033632585 7:143173849-143173871 TTCCTTGTAGTGTCTTTGTCTGG - Intergenic
1034025132 7:147694318-147694340 TTTCTTATAATGTCTTTGTCTGG + Intronic
1034403944 7:150888875-150888897 TTTCTTGTGATGTCTTTGTCTGG - Intergenic
1035075625 7:156175462-156175484 TTCTTTTTGTTGACTCTGTCTGG + Intergenic
1035229596 7:157456822-157456844 TTTCTTGTGATGTCTTTGTCTGG + Intergenic
1035485723 7:159224189-159224211 TTTCTTATGATGTCTTTTTCTGG - Intergenic
1035545231 8:476330-476352 TTTCTTATAGTGTCTTTGTCTGG + Intergenic
1035579794 8:732230-732252 TTCCTCATGTGGGCTGTCTCAGG + Intronic
1035811716 8:2497283-2497305 TTCCTGTTGCTGTCTCTGTCCGG - Intergenic
1035875094 8:3179792-3179814 TTACTTATGTAGGATGTGTCTGG - Intronic
1036125488 8:6058014-6058036 TTTCTTACGTTTTCTGTGACAGG - Intergenic
1036468582 8:9028037-9028059 TTCCTCATGAGGTCTTTGTCAGG + Intronic
1037004752 8:13763863-13763885 TTTCTTGTGATGTCTTTGTCTGG - Intergenic
1037495061 8:19431626-19431648 TTCCTTGTTCTGTCTTTGTCTGG + Intronic
1038294264 8:26276489-26276511 TTCCATATCTTTTCTGTGTAGGG + Intergenic
1038648111 8:29378205-29378227 TTCCTTTTGCTGGCTTTGTCGGG + Intergenic
1040098864 8:43478907-43478929 TTCCTTTTCTCGTCTTTGTCAGG - Intergenic
1040518827 8:48157779-48157801 TTTCTTATAGTGTCTTTGTCTGG - Intergenic
1040661262 8:49578656-49578678 TTCCCCATGTTATCTGTGACAGG - Intergenic
1041008659 8:53520179-53520201 ATCCTTATGTTATCTATGTTGGG - Intergenic
1041336527 8:56790808-56790830 TTCCTCTTGCTGTCTTTGTCTGG - Intergenic
1042006757 8:64189024-64189046 TTCCTTGTGGTGTCATTGTCTGG - Intergenic
1042264359 8:66893029-66893051 TTCCTTATAATGTCGTTGTCTGG + Intronic
1042717203 8:71787155-71787177 TACCTTGTTTTGTCTTTGTCTGG + Intergenic
1043102451 8:76063005-76063027 TTACTTATGATGTCTTTGTCTGG - Intergenic
1043800457 8:84603357-84603379 TTCCTCCTTTTGTCTTTGTCAGG + Intronic
1044572645 8:93736902-93736924 TGGCTTTTGTTCTCTGTGTCTGG - Intronic
1044638312 8:94351260-94351282 TTTCTTATAGTGTCTTTGTCTGG - Intergenic
1045025420 8:98082156-98082178 TTCCCTATTTTGTGTGTGTATGG + Intronic
1045102903 8:98863157-98863179 ATCTTGATGTTGTCTGTGTCAGG - Intronic
1045573508 8:103394160-103394182 TTCCACATCTTGTCTATGTCTGG + Intergenic
1046239809 8:111475829-111475851 TTCTTTCTGCTGTGTGTGTCGGG + Intergenic
1046720353 8:117612102-117612124 TTCCTTCTGTCTTCTGTTTCTGG - Intergenic
1047839166 8:128730648-128730670 TTCCTTGTGATATCTTTGTCTGG + Intergenic
1048149480 8:131880162-131880184 TTCCTTGTTGTGTCTGTGCCAGG + Intergenic
1049078248 8:140418380-140418402 TTTCTTTTGATGTCTGTTTCTGG - Intronic
1049926336 9:411626-411648 TTTCTCATGATGTCTTTGTCTGG - Intronic
1050400791 9:5251617-5251639 TTCCTTATGGATTTTGTGTCTGG - Intergenic
1050814919 9:9798296-9798318 TTTCTGAAGGTGTCTGTGTCAGG - Intronic
1051543024 9:18242039-18242061 TTTCTTGTGATGTCTTTGTCTGG - Intergenic
1052592645 9:30518149-30518171 TTCCTTTTGTTATCTTTCTCCGG + Intergenic
1053462177 9:38279473-38279495 TTCCTTCTCTTGACAGTGTCTGG - Intergenic
1056023911 9:82471720-82471742 TTTCTTGTGATGTCTTTGTCTGG - Intergenic
1056130098 9:83576073-83576095 TTTCTTATGATGTCTTTGTCTGG - Intergenic
1056994141 9:91439977-91439999 TTTCTTGTGATGTCTTTGTCTGG + Intergenic
1057267413 9:93628212-93628234 TTTCTTATAGTGTCTCTGTCTGG + Intronic
1057808562 9:98239629-98239651 TTTCTTATGATGTCTTTGTTTGG + Intronic
1058125701 9:101192133-101192155 TCCCTTATTTTGTGTGTCTCAGG + Intronic
1058144167 9:101392817-101392839 TTTTTTATTTTGTCTTTGTCTGG - Intronic
1060549954 9:124480227-124480249 TTCCTCACCTTGTCTGTCTCAGG + Intergenic
1061919159 9:133772634-133772656 TTTCTTGTGATGTCTGTGTCTGG - Intronic
1062306548 9:135910353-135910375 TTTCTTGTGGTGTCTGTGTCTGG + Intergenic
1062686220 9:137814803-137814825 CTGCTTATGTTGTGTGTATCTGG + Intronic
1203368833 Un_KI270442v1:283083-283105 TTTCTTATGGTGCCTTTGTCTGG - Intergenic
1186252211 X:7680473-7680495 GTCCTCATATTGTCTGTGTGAGG - Intergenic
1188432159 X:30116337-30116359 TTTCTTACATTGTCTTTGTCTGG - Intergenic
1188500225 X:30817700-30817722 TTCCTCGTGATGTCTTTGTCTGG - Intergenic
1188732495 X:33668188-33668210 CTCCTTTTGTTGTCTTTGTAAGG + Intergenic
1189851827 X:45185587-45185609 TTTCTCAACTTGTCTGTGTCAGG + Intronic
1190112429 X:47601699-47601721 TTTCTTATGATGTCTTTTTCTGG - Intronic
1190583667 X:51915161-51915183 TTTTTTATGGTGTCTTTGTCTGG - Intergenic
1190801452 X:53793143-53793165 TTTCTTAAGGTGTCTTTGTCTGG + Intergenic
1193045113 X:77045418-77045440 TTCATTGTGTTGTCTTTGTCTGG - Intergenic
1193248767 X:79263394-79263416 TTCCTTTTGTTCTCTTTTTCTGG + Intergenic
1193451400 X:81672878-81672900 TTTCTTGTGTTATCTGTGTTTGG + Intergenic
1193486976 X:82097408-82097430 TTGCTTTGGTTGTCTGTGCCTGG + Intergenic
1193575998 X:83195931-83195953 TTTTTTCTGTTGTCTCTGTCTGG + Intergenic
1193628643 X:83852322-83852344 TTTCTTATACTGTCTTTGTCTGG - Intergenic
1193782470 X:85720593-85720615 TTTCTTGTGGTGTCTTTGTCTGG + Intergenic
1193963186 X:87950417-87950439 TTCCTTGTGGTGTCTTTGTCTGG - Intergenic
1194162932 X:90477707-90477729 TTATTTATGATGTCTTTGTCTGG - Intergenic
1194310653 X:92301731-92301753 TTTCTTGTGTTGTCTTTGCCTGG + Intronic
1194320897 X:92445021-92445043 TTTCTTATTGTGTCTTTGTCAGG + Intronic
1194505763 X:94731484-94731506 TTTCTTATAGTGTCTTTGTCTGG + Intergenic
1194539147 X:95148757-95148779 TTTCTTATGTTGTCCTTTTCTGG + Intergenic
1194595622 X:95853579-95853601 TTTTTTAAGTTGTCTTTGTCTGG - Intergenic
1194636837 X:96355487-96355509 TTTCTTGTGGTGTCTTTGTCTGG - Intergenic
1194757258 X:97751831-97751853 TTTCTTATTTTGATTGTGTCAGG + Intergenic
1194948418 X:100095630-100095652 TTCCCCATGTTGCCTGTGGCTGG - Intergenic
1194985693 X:100487268-100487290 TTCCTTACATTTTCTGTGTCTGG + Intergenic
1195046841 X:101062135-101062157 GCTCTTATGTTGTCTGTGGCAGG + Intergenic
1195250367 X:103038502-103038524 TTTCTTATAGTGTCTGTGGCTGG + Intergenic
1196317381 X:114244190-114244212 TTTCTTGTGATGTCTTTGTCAGG - Intergenic
1196523586 X:116704551-116704573 TTTCTTTTTTTGTCTTTGTCTGG + Intergenic
1197433590 X:126397524-126397546 TTCCTTGTAATGTCTTTGTCTGG + Intergenic
1198869777 X:141164689-141164711 TTTTTTATGATGTCTTTGTCTGG - Intergenic
1199052650 X:143255007-143255029 TTTCTTATTGTGTCTTTGTCAGG - Intergenic
1199232571 X:145454665-145454687 TTCCTTTTAATGTCTGTGTCTGG - Intergenic
1199271397 X:145886888-145886910 TTGATCATGTTATCTGTGTCAGG - Intergenic
1199300124 X:146204042-146204064 TTTCTTATAGTGTCTTTGTCTGG + Intergenic
1199337310 X:146633689-146633711 TTTCTCATGATGTCTTTGTCTGG - Intergenic
1199702665 X:150395394-150395416 TTCCTTGTAATGTCTTTGTCTGG + Intronic
1199750430 X:150811582-150811604 TTTCTTGTGATGTCTTTGTCTGG - Intronic
1200315972 X:155133561-155133583 TTCCATATGATGTCTTTGTCTGG - Intronic
1200509206 Y:4055439-4055461 TTATTTATGATGTCTTTGTCTGG - Intergenic
1200618934 Y:5416016-5416038 TTTCTTGTGTTGTCTTTGCCTGG + Intronic
1200629012 Y:5558153-5558175 TTTCTTATTGTGTCTTTGTCAGG + Intronic
1201731538 Y:17210094-17210116 TTCCTTATGAGGTCTGTGAGGGG - Intergenic